Basic Information Gene Taxonomy: GPR89A UniprotID: B7ZAQ6 Mouse Homolog: Gpr89 Pharos Link: Pharos Link Knockout Mouse Phenotype: dermatitis abnormal ear lobe morphology premature death Decreased body weight Hyperkeratosis Failure to thrive Scaling skin Hypotrichosis Hypopigmentation of the skin abnormal hair follicle morphology enlarged sebaceous gland impaired skin barrier function abnormal epidermis stratum basale morphology abnormal keratinocyte morphology abnormal epidermis stratum corneum morphology abnormal skin development abnormal reproductive system development Monogenic Disease Association: Not Detected Polygenic Disease Association: Not Detected 10K Immunome: Not Detected SARS-CoV-2 Association: Not Detected SARS-CoV-2 Vaccine Association: Not Detected
Basic Information Gene Taxonomy: GPR89A Construct ID: IDG_GPR89A_UE_1 Virus Type: Lentiviral Vector Selection: Puro,Amp Vector: 783_hU6_EGFP Passed QC: On Vector Type: CRISPR Interference Sequence Inserted_sequence: GCTCTGAGGGGTAGACAGCT Media and Files Vector Map: Snapgene File: D6-783-GPR89A-interference-vector.dna