Basic Information Gene Taxonomy: KCNT1 UniprotID: Q5JUK3 Mouse Homolog: Kcnt1 Pharos Link: Pharos Link Knockout Mouse Phenotype: abnormal mechanical nociception no abnormal phenotype detected impaired ability to fire action potentials decreased channel response intensity increased pruritus abnormal sensory neuron physiology Monogenic Disease Association: epileptic encephalopathy early infantile 14 autosomal dominant nocturnal frontal lobe epilepsy 5 Polygenic Disease Association: epilepsies partial epileptic encephalopathy autosomal dominant nocturnal frontal lobe epilepsy 10K Immunome: Not Detected SARS-CoV-2 Association: Not Detected SARS-CoV-2 Vaccine Association: Not Detected
Basic Information Gene Taxonomy: KCNT1 Construct ID: IDG_KCNT1_UE_1 Virus Type: Lentiviral Vector Selection: Puro,Amp Vector: 783_hU6_EGFP Passed QC: On Vector Type: CRISPR Interference Sequence Inserted_sequence: GGAGGGCGCGGGCGGTGAGG Media and Files Vector Map: Snapgene File: F11-783-KCNT1-interference-vector.dna