Skip to main content
Loading...

Basic Information

Gene Taxonomy:
Virus Type:
Vector Type:
Construct ID:
IDG_SCN3B_OE_1

Selection:
Amp, Blasticidin

Vector:
lPX304

Construct Type:
Expression

Tag:
C terminal V5

Passed QC:
Yes

Sequence

Inserted_sequence:
ATGCCTGCCTTCAATAGATTGTTTCCCCTGGCTTCTCTCGTGCTTATCTACTGGGTCAGTGTCTGCTTCCCTGTGTGTGT
GGAAGTGCCCTCGGAGACGGAGGCCGTGCAGGGCAACCCCATGAAGCTGCGCTGCATCTCCTGCATGAAGAGAGAGGAGG
TGGAGGCCACCACGGTGGTGGAATGGTTCTACAGGCCCGAGGGCGGTAAAGATTTCCTTATTTACGAGTATCGGAATGGC
CACCAGGAGGTGGAGAGCCCCTTTCAGGGGCGCCTGCAGTGGAATGGCAGCAAGGACCTGCAGGACGTGTCCATCACTGT
GCTCAACGTCACTCTGAACGACTCTGGCCTCTACACCTGCAATGTGTCCCGGGAGTTTGAGTTTGAGGCGCATCGGCCCT
TTGTGAAGACGACGCGGCTGATCCCCCTAAGAGTCACCGAGGAGGCTGGAGAGGACTTCACCTCTGTGGTCTCAGAAATC
ATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGC
CGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGG
AGGAATTGCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files