Skip to main content
Loading...

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-HTR3E-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

 

Single Cell Clones:

E3, F4, F6. Majority of cells are expressing V5 at very low intensity.  

 

Sequence

ORF Sequence:

atgtctgccatcctagatgtgaatgaacagctgcacctcttgtcatcattcctgtggctggaaatggtttgggataaccc atttatcagctggaacccagaggaatgtgagggcatcacgaagatgagtatggcagccaagaacctgtggctcccagaca ttttcatcattgaactcatggatgtggataagaccccaaaaggcctcacagcatatgtaagtaatgaaggtcgcatcagg tataagaaacccatgaaggtggacagtatctgtaacctggacatcttctacttccccttcgaccagcagaactgcacact caccttcagctcattcctctacacagtggacagcatgttgctggacatggagaaagaagtgtgggaaataacagacgcat cccggaacatccttcagacccatggagaatgggagctcctgggcctcagcaaggccaccgcaaagttgtccagggtggcc atcaggcgcaggcccagcctctatgtcataaaccttctcgtgcccagtggctttctggttgccatcgatgccctcagctt ctacctgccagtgaaaagtgggaatcgtgtcccattcaagataacgctcctgctgggctacaacgtcttcctgctcatga tgagtgacttgctccccaccagtggcacccccctcatcggtgtctacttcgccctgtgcctgtccctgatggtgggcagc ctgctggagaccatcttcatcacccacctgctgcacgtggccaccacccagcccccacccctgcctcggtggctccactc cctgctgctccactgcaacagcccggggagatgctgtcccactgcgccccagaaggaaaataagggcccgggtctcaccc ccacccacctgcccggtgtgaaggagccagaggtatcagcagggcagatgccgggccctgcggaggcagagctgacaggg ggctcagaatggacaagggcccagcgggaacacgaggcccagaagcagcactcagtggagctgtggttgcagttcagcca cgcgatggacgccatgctcttccgcctctacctgctcttcatggcctcctctatcatcaccgtcatatgcctctggaaca ccTTGCCAACTTTCTTGTACAAAGTGGTtggtaagcctatccctaaccctctcctcggtctcgattctacgtag

Media and Files