Skip to main content
Loading...

Over Expression Cell Lines

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-TMEM63C-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGTCTGCCTCACCAGACGACCTGAGTACAGGGGGAAGGTTACAGAACATGACAGTGGATGAATGCTTCCAGTCTCGGAA
CACCGTCCTCCAGGGGCAGCCCTTTGGGGGTGTCCCCACCGTGCTGTGCCTCAACATCGCCCTGTGGGTGCTCGTCCTTG
TGGTTTACTCCTTCCTCCGGAAAGCTGCGTGGGACTATGGGCGCCTGGCTCTGCTGATACACAATGACAGCCTGACCTCG
CTGATCTATGGGGAGCAGAGCGAGAAGACATCTCCCTCGGAGACTTCCTTGGAGATGGAACGCAGAGACAAGGGATTCTG
TTCCTGGTTCTTCAACAGCATAACAATGAAGGACGAGGATCTGATTAACAAGTGTGGGGACGACGCGCGCATCTACATCG
TGTTCCAGTACCACCTCATCATCTTTGTGCTCATCATCTGTATCCCCTCCCTGGGCATCATTTTGCCCATCAACTATACT
GGATCTGTTCTGGACTGGAGCAGTCACTTTGCTCGGACCACCATTGTCAATGTCTCCACAGAGAGCAAGCTCCTGTGGCT
GCATAGCCTGCTGTCCTTCTTCTACTTCATCACCAACTTCATGTTCATGGCTCATCACTGCCTGGGGTTTGCGCCCAGGA
ATAGCCAAAAGGTCACAAGGACACTAATGATCACCTATGTGCCCAAGGACATTGAAGACCCAGAACTCATCATTAAGCAT
TTTCACGAGGCCTATCCAGGCAGTGTCGTGACAAGAGTCCACTTCTGCTACGACGTCAGGAACCTGATCGACTTGGACGA
TCAGAGGCGCCATGCCATGCGGGGCCGGCTTTTCTATACAGCCAAGGCCAAGAAGACTGGGAAGGTGATGATCAGGATCC
ACCCCTGTGCCCGCCTGTGCTTCTGCAAGTGCTGGACCTGCTTCAAGGAGGTGGATGCAGAGCAGTATTACAGCGAGCTA
GAGGAGCAGCTAACGGACGAGTTCAACGCCGAGCTCAACCGCGTGCCGCTCAAGCGGCTGGACCTGATCTTTGTCACCTT
CCAGGACTCCAGGATGGCCAAGCGTGTCCGTAAGGATTACAAGTATGTCCAGTGTGGTGTGCAACCCCAGCAGTCCTCAG
TGACCACCATCGTCAAATCATATTACTGGAGGGTCACTATGGCCCCACACCCCAAAGACATTATTTGGAAACACCTGTCT
GTCCGCCGCTTCTTTTGGTGGGCCCGCTTTATCGCAATCAACACCTTCCTCTTCTTCCTCTTCTTCTTTCTCACCACGCC
TGCCATCATCATGAACACTATCGACATGTACAACGTCACCCGCCCCATCGAGAAGCTGCAGAACCCAATTGTGACCCAGT
TCTTCCCCTCTGTGATGCTCTGGGGCTTCACAGTGATACTGCCTCTGATTGTCTACTTCTCCGCCTTCCTCGAGGCCCAC
TGGACCAGATCAAGTCAGAATCTGGTCATGGTGCACAAGTGCTACATCTTTCTGGTGTTCATGGTAGTCATTCTGCCCTC
TATGGGACTGACCAGTTTGGATGTCTTTCTCCGCTGGCTCTTTGACATCTACTATCTAGAGCAAGCATCCATCAGGTTCC
AGTGTGTGTTCCTGCCAGACAACGGCGCCTTCTTTGTCAACTACGTGATCACGGCAGCTTTACTTGGCACAGGCATGGAG
CTGCTGCGTCTGGGGTCACTCTTCTGCTACAGCACCCGCCTCTTCTTCTCTAGATCAGAGCCAGAGAGAGTCAACATCAG
AAAGAACCAGGCCATAGACTTCCAGTTTGGGCGTGAGTATGCGTGGATGATGAACGTGTTCAGCGTGGTGATGGCGTACA
GCATCACTTGCCCCATCATTGTGCCTTTTGGGTTGCTCTACCTGTGCATGAAGCACTTGACGGATCGCTATAACATGTAC
TACTCCTTTGCACCCACCAAACTGAACGAGCAGATCCACATGGCTGCCGTCTCCCAGGCCATCTTTGCGCCACTCTTGGG
TCTGTTCTGGATGCTGTTCTTCTCCATCCTGCGGTTGGGTTCTCTCCACGCCATCACCATCTTTTCCCTGTCCACCCTCC
TCATTGCCATGGTGATTGCCTTTGTTGGCATTTTTCTGGGGAAGCTTCGGATGGTTGCCGACTACGAGCCCGAGGAGGAG
GAGATCCAGACAGTGTTTGACATGGAGCCAAGCAGCACCTCCTCCACGCCCACCTCCCTCCTGTATGTGGCCACCGTGCT
GCAAGAACCGGAGTTGAATCTGACCCCCGCCTCCTCCCCAGCCAGGCACACCTATGGCACCATGAACAACCAGCCGGAAG
AGGGAGAAGAAGAGAGTGGTCTGAGGGGCTTTGCGAGGGAGCTAGACTCGGCCCAGTTCCAGGAAGGGCTGGAACTGGAG
GGCCAGAACCAGTACCACTTGCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGA
TTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-SCNN1B-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGCACGTGAAGAAGTACCTGCTGAAGGGCCTGCATCGGCTGCAGAAGGGCCCCGGCTACACGTACAAGGAGCTGCTGGT
GTGGTACTGCGACAACACCAACACCCACGGCCCCAAGCGCACCATCTGTGAGGGGCCCAAGAAGAAAGCCATGTGGTTCC
TGCTCACCCTGCTCTTCGCCGCCCTCGTCTGCTGGCAGTGGGGCATCTTCATCAGGACCTACTTGAGCTGGGAGGTCAGC
GTCTCCCTCTCCGTAGGCTTCAAGACCATGGACTTCCCTGCCGTCACCATCTGCAATGCTAGCCCCTTCAAGTATTCCAA
AATCAAGCATTTGCTGAAGGACCTGGATGAGCTGATGGAAGCTGTCCTGGAGAGAATCCTGGCTCCTGAGCTAAGCCATG
CCAATGCCACCAGGAACCTGAACTTCTCCATCTGGAACCACACACCCCTGGTCCTTATTGATGAACGGAACCCCCACCAC
CCCATGGTCCTTGATCTCTTTGGAGACAACCACAATGGCTTAACAAGCAGCTCAGCATCAGAAAAGATCTGTAATGCCCA
CGGGTGCAAAATGGCCATGAGACTATGTAGCCTCAACAGGACCCAGTGTACCTTCCGGAACTTCACCAGTGCTACCCAGG
CATTGACAGAGTGGTACATCCTGCAGGCCACCAACATCTTTGCACAGGTGCCACAGCAGGAGCTAGTAGAGATGAGCTAC
CCCGGCGAGCAGATGATCCTGGCCTGCCTATTCGGAGCTGAGCCCTGCAACTACCGGAACTTCACGTCCATCTTCTACCC
TCACTATGGCAACTGTTACATCTTCAACTGGGGCATGACAGAGAAGGCACTTCCTTCGGCCAACCCTGGAACTGAATTCG
GCCTGAAGTTGATCCTGGACATAGGCCAGGAAGACTACGTCCCCTTCCTTGCGTCCACGGCCGGGGTCAGGCTGATGCTT
CACGAGCAGAGGTCATACCCCTTCATCAGAGATGAGGGCATCTACGCCATGTCGGGGACAGAGACGTCCATCGGGGTACT
CGTGGACAAGCTTCAGCGCATGGGGGAGCCCTACAGCCCGTGCACCGTGAATGGTTCTGAGGTCCCCGTCCAAAACTTCT
ACAGTGACTACAACACGACCTACTCCATCCAGGCCTGTCTTCGCTCCTGCTTCCAAGACCACATGATCCGTAACTGCAAC
TGTGGCCACTACCTGTACCCACTGCCCCGTGGGGAGAAATACTGCAACAACCGGGACTTCCCAGACTGGGCCCATTGCTA
CTCAGATCTACAGATGAGCGTGGCGCAGAGAGAGACCTGCATTGGCATGTGCAAGGAGTCCTGCAATGACACCCAGTACA
AGATGACCATCTCCATGGCTGACTGGCCTTCTGAGGCCTCCGAGGACTGGATTTTCCACGTCTTGTCTCAGGAGCGGGAC
CAAAGCACCAATATCACCCTGAGCAGGAAGGGAATTGTCAAGCTCAACATCTACTTCCAAGAATTTAACTATCGCACCAT
TGAAGAATCAGCAGCCAATAACATCGTCTGGCTGCTCTCGAATCTGGGTGGCCAGTTTGGCTTCTGGATGGGGGGCTCTG
TGCTGTGCCTCATCGAGTTTGGGGAGATCATCATCGACTTTGTGTGGATCACCATCATCAAGCTGGTGGCCTTGGCCAAG
AGCCTACGGCAGCGGCGAGCCCAAGCCAGCTACGCTGGCCCACCGCCCACCGTGGCCGAGCTGGTGGAGGCCCACACCAA
CTTTGGCTTCCAGCCTGACACGGCCCCCCGCAGCCCCAACACTGGGCCCTACCCCAGTGAGCAGGCCCTGCCCATCCCAG
GCACCCCGCCCCCCAACTATGACTCCCTGCGTCTGCAGCCGCTGGACGTCATCGAGTCTGACAGTGAGGGTGATGCCATC
TACCCAACTTTCTTGTACAAAGTGGTtggtaagcctatccctaaccctctcctcggtctcgattctacgtag

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-TTYH2-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGCAGGCGGCGCGCGTGGACTACATCGCTCCCTGGTGGGTCGTGTGGCTGCACAGCGTCCCGCACGTCGGCCTGCGCCT
GCAGCCCGTGAACAGCACCTTCAGCCCCGGCGACGAGAGTTACCAGGAGTCGCTGCTGTTCCTGGGGCTGGTGGCCGCCG
TCTGCCTGGGCCTGAACCTCATCTTCCTTGTGGCTTACCTGGTCTGTGCATGCCACTGCCGGCGGGACGATGCGGTGCAG
ACCAAGCAGCACCACTCCTGCTGCATCACCTGGACGGCCGTGGTGGCCGGGCTCATCTGCTGTGCTGCGGTGGGCGTTGG
TTTCTATGGAAACAGCGAGACCAACGATGGGGCGTACCAGCTGATGTACTCCTTGGACGATGCCAACCACACCTTCTCTG
GGATCGATGCTCTGGTTTCCGGAACTACCCAGAAGATGAAGGTGGACCTAGAGCAGCACCTGGCCCGGCTCAGTGAGATC
TTTGCTGCCCGGGGCGATTACCTGCAGACCCTGAAGTTCATACAGCAGATGGCGGGCAGCGTTGTTGTTCAGCTCTCAGG
ACTGCCCGTGTGGAGGGAGGTCACCATGGAGCTGACCAAGCTATCCGACCAGACTGGCTACGTGGAGTACTACAGGTGGC
TCTCCTACCTCCTGCTCTTTATCCTGGACCTGGTCATCTGCCTCATTGCCTGCCTGGGACTGGCCAAGCGCTCCAAGTGT
CTCCTGGCCTCGATGCTGTGCTGTGGGGCACTGAGCCTGCTCCTCAGTTGGGCATCCCTGGCCGCTGATGGCTCTGCGGC
AGTGGCCACCAGTGACTTCTGTGTGGCTCCTGACACCTTCATCCTGAACGTCACGGAGGGCCAGATCAGCACAGAGGTGA
CTCGCTACTACCTGTATTGCAGCCAGAGTGGAAGCAGCCCCTTCCAGCAGACCCTGACCACCTTCCAGCGCGCACTTACC
ACCATGCAGATCCAGGTCGCGGGGCTGCTGCAGTTTGCCGTGCCCCTCTTCTCCACTGCAGAGGAAGACCTGCTTGCAAT
CCAGCTCCTGCTGAACTCCTCAGAGTCCAGCCTTCACCAGCTGACCGCCATGGTGGACTGCCGAGGGCTGCACAAGGATT
ATCTGGACGCTCTTGCTGGCATCTGCTACGACGGCCTCCAGGGCTTGCTGTACCTTGGCCTCTTCTCCTTCCTGGCCGCC
CTCGCCTTCTCCACCATGATCTGTGCAGGGCCAAGGGCCTGGAAGCACTTCACCACCAGAAACAGAGACTACGATGACAT
TGATGATGATGACCCCTTTAACCCCCAAGCCTGGCGCATGGCGGCTCACAGTCCCCCGAGGGGACAGCTTCACAGCTTCT
GCAGCTACAGCAGTGGCCTGGGAAGTCAGACCAGCCTGCAGCCCCCGGCCCAGACCATCTCCAACGCCCCTGTCTCCGAG
TACATGAACCAAGCCATGCTCTTTGGTAGGAACCCACGCTACGAGAACGTGCCACTAATCGGGAGAGCCTCCCCTCCGCC
TACGTACTCTCCCAGCATGAGAGCCACCTACCTGTCTGTGGCGGATGAGCACCTGAGGCACTACGGGAATCAGTTTCCAG
CCTTGCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-SCNN1D-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGCTGAGCACCGAAGCATGGACGGGAGAATGGAAGCAGCCACACGGGGGGGCTCTCACCTCCAGGCTGCAGCCCAGAC
GCCCCCCAGGCCGGGGCCACCATCAGCACCACCACCACCACCCAAGGAGGGGCACCAGGAGGGGCTGGTGGAGCTGCCCG
CCTCGTTCCGGGAGCTGCTCACCTTCTTCTGCACCAATGCCACCATCCACGGCGCCATCCGCCTGGTCTGCTCCCGCGGG
AACCGCCTCAAGACGACGTCCTGGGGGCTGCTGTCCCTGGGAGCCCTGGTCGCGCTCTGCTGGCAGCTGGGGCTCCTCTT
TGAGCGTCACTGGCACCGCCCGGTCCTCATGGCCGTCTCTGTGCACTCGGAGCGCAGCTGCTCCCGCTGGTCACCCTGTG
TGACGGGAACCCACGTCGGCCGAGTCCGGTCCTCCGCCATCTGGAGCTGCTGGACGAGTTTGCCAGGGAGAACATTGACT
CCCTGTACAACGTCAACCTCAGCAAAGGCAGAGCCGCCCTCTCCGCCACTGTCCCCCGCCACGAGCCCCCCTTCCACCTG
GACCGGGAGATCCGTCTGCAGAGGCTGAGCCACTCGGGCAGCCGGGTCAGAGTGGGGTTCAGACTGTGCAACAGCACGGG
CGGCGACTGCTTTTACCGAGGCTACACGTCAGGCGTGGCGGCTGTCCAGGACTGGTACCACTTCCACTATGTGGATATCC
TGGCCCTGCTGCCCGCGGCATGGGAGGACAGCCACGGGAGCCAGGACGGCCACTTCGTCCTCTCCTGCAGTTACGATGGC
CTGGACTGCCAGGCCCGACAGTTCCGGACCTTCCACCACCCCACCTACGGCAGCTGCTACACGGTCGATGGCGTCTGGAC
AGCTCAGCGCCCCGGCATCACCCACGGAGTCGGCCTGGTCCTCAGGGTTGAGCAGCAGCCTCACCTCCCTCTGCTGTCCA
CGCTGGCCGGCATCAGGGTCATGGTTCACGGCCGTAACCACACGCCCTTCCTGGGGCACCACAGCTTCAGCGTCCGGCCA
GGGACGGAGGCCACCATCAGCATCCGAGAGGACGAGGTGCACCGGCTCGGGAGCCCCTACGGCCACTGCACCGCCGGCGG
GGAAGGCGTGGAGGTGGAGCTGCTACACAACACCTCCTACACCAGGCAGGCCTGCCTGGTGTCCTGCTTCCAGCAGCTGA
TGGTGGAGACCTGCTCCTGTGGCTACTACCTCCACCCTCTGCCGGCGGGGGCTGAGTACTGCAGCTCTGCCCGGCACCCT
GCCTGGGGACACTGCTTCTACCGCCTCTACCAGGACCTGGAGACCCACCGGCTCCCCTGTACCTCCCGCTGCCCCAGGCC
CTGCAGGGAGTCTGCATTCAAGCTCTCCACTGGGACCTCCAGGTGGCCTTCCGCCAAGTCAGCTGGATGGACTCTGGCCA
CGCTAGGTGAACAGGGGCTGCCGCATCAGAGCCACAGACAGAGGAGCAGCCTGGCCAAAATCAACATCGTCTACCAGGAG
CTCAACTACCGCTCAGTGGAGGAGGCGCCCGTGTACTCGGTGCCGCAGCTGCTCTCGGCCATGGGCAGCCTCTGCAGCCT
GTGGTTTGGGGCCTCCGTCCTCTCCCTCCTGGAGCTCCTGGAGCTGCTGCTCGATGCTTCTGCCCTCACCCTGGTGCTAG
GCGGCCGCCGGCTCCGCAGGGCGTGGTTCTCCTGGCCCAGAGCCAGCCCTGCCTCAGGGGCGTCCAGCATCAAGCCAGAG
GCCAGTCAGATGCCCCCGCCTGCAGGCGGCACGTCAGATGACCCGGAGCCCAGCGGGCCTCATCTCCCACGGGTGATGCT
TCCAGGGGTTCTGGCGGGAGTCTCAGCCGAAGAGAGCTGGGCTGGGCCCCAGCCCCTTGAGACTCTGGACACCTTGCCAA
CTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-TMC4-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGAAGGGTGGGGGCGGTCAGAGGGATGTTGGCGCTGACAGGACCGTGTTTCTTCGCCTCGCCTCCCTGGTGGTCCTGCT
CTTCTCTCTCTGGAATCAGATCACTTGTGGGGGCGACTCCGAGGCTGAGGACTGCAAAACCTGTGGCTACAATTACAAAC
AACTTCCGTGCTGGGAGACTGTCCTGGGCCAGGAAATGTACAAACTTCTGCTCTTTGATCTGCTGACTGTCTTGGCAGTC
GCGCTGCTCATCCAGTTTCCTAGAAAGCTCCTCTGTGGCCTCTGTCCTGGGGCGCTGGGTCGTCTGGCGGGGACCCAGGA
GTTCCAGGTGCCCGACGAGGTGCTGGGGCTCATCTACGCGCAGACGGTGGTCTGGGTGGGGAGTTTTTTCTGCCCTTTAC
TGCCCCTGCTTAACACGGTCAAGTTCCTGCTGCTTTTCTACCTGAAGAAGCTTACCCTCTTCTCCACCTGCTCCCCGGCT
GCCCGCACCTTCCGGGCCTCCGCGGCGAATTTCTTTTTCCCCTTGGTCCTTCTCCTGGGTCTGGCCATCTCCAGCGTTCC
CCTGCTTTACAGCATCTTCCTGATCCCGCCTTCTAAGCTTTGTGGTCCATTCCGGGGGCAGTCGTCCATCTGGGCCCAGA
TCCCTGAGTCTATTTCCAGCCTCCCTGAGACCACCCAGAATTTCCTCTTCTTCCTGGGGACCCAGGCTTTTGCTGTGCCC
CTTCTGCTGATCTCCAGCATCCTGATGGCGTACACTGTGGCTCTGGCTAACTCCTACGGACGCCTCATCTCTGAGCTCAA
ACGTCAGAGACAGACGGAGGCGCAGAATAAAGTCTTCCTGGCACGGCGCGCTGTGGCGCTGACCTCCACCAAACCGGCTC
TTTGCCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-TMEM63A-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGATGGACTCCCCGTTCCTGGAGCTGTGGCAGTCCAAGGCAGTGTCCATCAGGGAGCAGCTGGGACTCGGGGACCGGCC
CAACGACTCCTATTGCTACAACTCGGCCAAAAACAGCACCGTGCTCCAGGGGGTCACCTTTGGTGGCATCCCCACTGTCC
TGCTCATAGACGTCAGCTGCTTCCTGTTCTTAATCTTGGTGTTTTCTATTATAAGAAGAAGATTCTGGGACTATGGCCGC
ATTGCCCTGGTGTCAGAAGCAGACAGCGAGTCCAGATTTCAGAGATTGTCATCGACTTCCTCCTCAGGTCAACAAGACTT
TGAAAATGAGCTGGGATGCTGTCCCTGGCTGACTGCCATCTTCCGTCTGCATGATGACCAGATCCTGGAATGGTGTGGGG
AGGACGCCATCCACTACCTGTCCTTCCAGAGGCACATCATCTTCCTGTTGGTGGTGGTCAGCTTTTTGTCCCTGTGTGTC
ATCCTGCCTGTCAACCTCTCAGGGGACTTGCTGGACAAAGACCCGTATAGTTTTGGGAGGACAACAATAGCAAACCTACA
GACTGACAATGACCTCCTTTGGCTGCACACCATCTTTGCTGTCATTTACCTCTTCCTCACTGTGGGTTTCATGCGGCACC
ACACTCAGTCCATTAAGTACAAAGAGGAGAACCTGGTGAGGCGGACCCTGTTCATCACAGGACTCCCCAGAGATGCCAGG
AAGGAGACTGTGGAGAGCCACTTCCGGGACGCGTATCCCACGTGTGAGGTGGTTGATGTGCAGCTGTGCTACAACGTGGC
CAAACTGATCTACCTGTGCAAGGAGAAAAAGAAGACTGAGAAGAGCCTGACCTATTACACAAACCTGCAGGTGAAGACAG
GCCAGCGGACCCTCATCAACCCCAAGCCCTGTGGCCAGTTTTGCTGCTGTGAAGTGCTGGGCTGTGAGTGGGAAGACGCC
ATCTCTTACTACACACGGATGAAGGACAGGCTGCTGGAGAGGATCACAGAGGAAGAACGCCACGTCCAGGACCAGCCCCT
GGGAATGGCCTTCGTCACCTTCCAGGAGAAGTCCATGGCCACCTACATCCTGAAAGATTTCAATGCCTGCAAGTGTCAGA
GCCTTCAGTGCAAAGGTGAGCCCCAGCCGTCCTCCCATAGCAGGGAGCTCTATACCTCCAAGTGGACAGTCACCTTTGCT
GCTGACCCTGAGGACATCTGCTGGAAGAACCTCTCTATCCAGGGCCTCCGCTGGTGGCTACAGTGGCTGGGCATCAACTT
CACCCTCTTCCTGGGGCTATTTTTCCTGACCACACCCTCCATCATCCTGTCCACCATGGACAAGTTTAATGTCACCAAAC
CCATCCATGCGCTGAATAACCCGATCATCAGCCAGTTCTTCCCCACCCTCCTGCTCTGGTCCTTCTCGGCCCTGCTCCCC
TCCATTGTCTACTACTCTACACTGCTGGAGTCTCACTGGACCAAGTCGGGGGAAAACCAGATCATGATGACCAAAGTCTA
CATATTCTTGATCTTCATGGTGCTGATCCTGCCCTCCCTGGGTCTCACCAGTCTAGATTTTTTCTTCCGGTGGCTCTTTG
ACAAAACTTCCTCGGAGGCCTCCATCAGGTTGGAGTGCGTCTTCCTGCCTGACCAGGGTGCCTTCTTTGTGAACTATGTC
ATCGCCTCGGCCTTCATCGGCAATGGCATGGAGCTGCTGCGGCTGCCAGGTCTCATCCTCTATACCTTCCGCATGATCAT
GGCCAAGACGGCTGCTGACCGCAGGAATGTCAAGCAGAACCAGGCCTTCCAGTACGAGTTTGGAGCCATGTATGCATGGA
TGCTGTGTGTCTTCACTGTCATCGTGGCCTACAGCATCACTTGTCCCATCATCGCGCCATTTGGCCTCATCTACATCCTG
CTCAAGCACATGGTGGACCGGCACAACCTCTACTTCGTCTACCTCCCAGCCAAGCTGGAGAAGGGGATCCACTTTGCCGC
TGTGAACCAGGCCTTGGCAGCCCCCATCCTGTGCCTCTTCTGGCTCTACTTCTTTTCCTTCCTGCGCCTGGGTATGAAGG
CCCCCGCCACTCTGTTCACCTTCCTGGTGCTGCTGCTCACCATCCTGGTCTGCCTGGCTCACACCTGCTTTGGATGCTTC
AAGCACCTCAGCCCTCTGAACTACAAAACAGAAGAGCCTGCAAGTGACAAAGGAAGTGAGGCAGAGGCCCACATGCCCCC
ACCGTTCACACCCTACGTGCCTCGGATTCTGAACGGCTTGGCCTCGGAGAGGACAGCACTGTCTCCGCAGCAGCAGCAGC
AGCAGACCTATGGTGCCATCCACAACATCAGCGGGACTATCCCTGGACAGTGCTTGGCGCAGAGCGCCACGGGCAGTGTG
GCTGCTGCCCCCCAGGAGGCCTGCCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCT
CGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-PLLP-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

 

Single Cell Clones: 

 

Clones E5 and H6 have high punctate intracellular and membraneous expression of V5. V5 expression in the membrane is high than intracellular expression. 

Sequence

ORF Sequence:

ATGGCCGAGTTCCCGTCGAAAGTTAGCACGCGGACCAGCAGTCCTGCGCAGGGCGCCGAAGCCTCGGTGTCGGCGCTGCG CCCGGACCTGGGCTTCGTGCGCTCCCGCCTCGGGGCGCTCATGCTGCTGCAGCTGGTGCTGGGGCTGCTGGTGTGGGCGC TGATTGCGGACACCCCGTACCACCTGTATCCGGCCTATGGCTGGGTGATGTTCGTCGCTGTCTTCCTCTGGCTGGTGACA ATCGTCCTCTTCAACCTCTACCTGTTTCAGCTGCACATGAAGTTGTACATGGTTCCCTGGCCACTGGTGTTAATGATCTT TAACATCAGCGCCACCGTTCTCTACATCACCGCCTTCATCGCCTGCTCTGCGGCAGTTGACCTGACATCCCTGAGGGGCA CCCGGCCTTATAACCAGCGCGCGGCTGCCTCGTTCTTTGCGTGTTTGGTGATGATCGCCTATGGAGTGAGTGCCTTCTTC AGCTACCAGGCCTGGCGAGGAGTAGGCAGCAATGCGGCCACCAGTCAGATGGCTGGCGGCTATGCCTACCCAACTTTCTT GTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-TMEM63B-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGCTGCCCTTTCTGCTGGCCACACTGGGCACCACAGCCCTCAACAACAGCAACCCCAAGGACTACTGCTACAGCGCCCG
CATCCGCAGCACTGTCCTGCAGGGCCTGCCCTTTGGGGGCGTCCCCACCGTGCTGGCTCTCGACTTCATGTGCTTCCTTG
CACTGCTGTTCTTATTCTCTATCCTCCGGAAGGTGGCCTGGGACTATGGGCGGCTGGCCTTGGTGACAGATGCAGACAGG
CTTCGGCGGCAGGAGAGGGACCGAGTGGAACAGGAATATGTGGCTTCAGCTATGCACGGGGACAGCCATGACCGGTATGA
GCGTCTCACCTCTGTCTCCAGCTCCGTTGACTTTGACCAAAGGGACAATGGTTTCTGTTCCTGGCTGACAGCCATCTTCA
GGATAAAGGATGATGAGATCCGGGACAAATGTGGGGGCGATGCCGTGCACTACCTGTCCTTTCAGCGGCACATCATCGGG
CTGCTGGTGGTTGTGGGCGTCCTCTCCGTAGGCATCGTGCTGCCTGTCAACTTCTCAGGGGACCTGCTGGAGAACAATGC
CTACAGCTTTGGGAGAACCACCATTGCCAACTTGAAATCAGGGAACAACCTGCTATGGCTGCACACCTCCTTCGCCTTCC
TGTATCTGCTGCTCACCGTCTACAGCATGCGTAGACACACCTCCAAGATGCGCTACAAGGAGGATGATCTGGTGAAGCGG
ACCCTCTTCATCAATGGAATCTCCAAATATGCAGAGTCAGAAAAGATCAAGAAGCATTTTGAGGAAGCCTACCCCAACTG
CACAGTTCTCGAAGCCCGCCCGTGTTACAACGTGGCTCGCCTAATGTTCCTCGATGCAGAGAGGAAGAAGGCCGAGCGGG
GAAAGCTGTACTTCACAAACCTCCAGAGCAAGGAGAACGTGCCTACCATGATCAACCCCAAGCCCTGTGGCCACCTCTGC
TGCTGTGTGGTGCGAGGCTGTGAGCAGGTGGAGGCCATTGAGTACTACACAAAGCTGGAGCAGAAGCTGAAGGAAGACTA
CAAGCGGGAGAAGGAGAAGGTGAATGAGAAGCCTCTTGGCATGGCCTTTGTCACCTTCCACAATGAGACTATCACCGCCA
TCATCCTGAAGGACTTCAACGTGTGTAAATGCCAGGGCTGCACCTGCCGTGGGGAGCCACGCCCCTCATCCTGCAGCGAG
TCCCTGCACATCTCCAACTGGACCGTGTCCTATGCCCCTGACCCTCAGAACATCTACTGGGAGCACCTCTCCATCCGAGG
CTTCATCTGGTGGCTGCGCTGCCTGGTCATCAATGTCGTCCTCTTCATCCTCCTCTTCTTCCTCACCACTCCAGCCATCA
TCATCACCACCATGGACAAGTTCAACGTCACCAAGCCTGTGGAGTACCTCAACAACCCCATCATCACCCAGTTCTTCCCC
ACCCTGCTGCTGTGGTGCTTCTCGGCCCTCCTTCCCACCATCGTCTACTACTCAGCCTTCTTTGAAGCCCACTGGACACG
CTCTGGGGAGAACAGGACAACCATGCACAAGTGCTACACTTTCCTCATCTTCATGGTGCTGCTCCTACCCTCGCTGGGAC
TGAGCAGCCTGGACCTCTTCTTCCGCTGGCTCTTTGATAAGAAATTCTTGGCTGAGGCAGCTATTCGGTTTGAGTGTGTG
TTCCTGCCCGACAACGGCGCCTTCTTCGTGAACTACGTCATTGCCTCAGCCTTTATCGGCAACGCCATGGACCTGCTGCG
CATCCCAGGCCTGCTCATGTACATGATCCGGCTCTGCCTGGCGCGCTCGGCCGCCGAGAGGCGCAACGTGAAGCGGCATC
AGGCCTACGAGTTCCAGTTTGGCGCAGCCTACGCCTGGATGATGTGCGTCTTCACGGTGGTCATGACCTACAGTATCACC
TGCCCCATCATCGTGCCCTTCGGGCTCATGTACATGCTGCTGAAGCACCTGGTAGACAGGTACAATCTCTACTACGCCTA
CCTGCCGGCCAAGCTGGACAAGAAGATCCACTCGGGGGCTGTGAACCAGGTGGTGGCCGCGCCCATCCTCTGCCTCTTCT
GGCTGCTCTTCTTTTCCACCATGCGCACGGGGTTCCTAGCTCCCACGTCTATGTTCACATTTGTGGTCCTGGTCATCACC
ATCGTCATCTGTCTCTGCCACGTCTGCTTTGGACACTTCAAATACCTCAGTGCCCACAACTACAAGATTGAGCACACGGA
GACAGATACTGTGGACCCCAGAAGCAATGGACGGCCCCCCACTGCTGCTGCTGTCCCCAAATCTGCGAAATACATCGCTC
AGGTGCTGCAGGACTCAGAGGTGGACGGGGATGGGGATGGGGCTCCTGGGAGCTCAGGGGATGAGCCCCCATCATCCTCA
TCCCAAGATGAGGAGTTGCTGATGCCACCCGACGCCCTCACGGACACAGACTTCCAGTCTTGCGAGGACAGCCTCATAGA
GAATGAGATTCACCAGACAGCTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTA
CGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-SCN2B-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGCACAGAGATGCCTGGCTACCTCGCCCTGCCTTCAGCCTCACGGGGCTCAGTCTCTTTTTCTCTTTGGTGCCACCAGG
ACGGAGCATGGAGGTCACAGTACCTGCCACCCTCAACGTCCTCAATGGCTCTGACGCCCGCCTGCCCTGCACCTTCAACT
CCTGCTACACAGTGAACCACAAACAGTTCTCCCTGAACTGGACTTACCAGGAGTGCAACAACTGCTCTGAGGAGATGTTC
CTCCAGTTCCGCATGAAGATCATTAACCTGAAGCTGGAGCGGTTTCAAGACCGCGTGGAGTTCTCAGGGAACCCCAGCAA
GTACGATGTGTCGGTGATGCTGAGAAACGTGCAGCCGGAGGATGAGGGGATTTACAACTGCTACATCATGAACCCCCCTG
ACCGCCACCGTGGCCATGGCAAGATCCATCTGCAGGTCCTCATGGAAGAGCCCCCTGAGCGGGACTCCACGGTGGCCGTG
ATTGTGGGTGCCTCCGTCGGGGGCTTCCTGGCTGTGGTCATCTTGGTGCTGATGGTGGTCAAGTGTGTGAGGAGAAAAAA
AGAGCAGAAGCTGAGCACAGATGACCTGAAGACCGAGGAGGAGGGCAAGACGGACGGTGAAGGCAACCCGGATGATGGCG
CCAAGTACCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-GLRA3-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGCCCACGTGAGACACTTTCGGACATTAGTTTCGGGATTTTACTTCTGGGAAGCAGCACTGTTACTCAGTTTGGTTGC
CACAAAGGAAACAGACAGTGCAAGATCTCGAAGTGCTCCAATGTCACCTTCTGATTTTCTGGATAAATTAATGGGCAGGA
CATCAGGATATGATGCAAGAATCAGACCCAATTTTAAAGGCCCTCCAGTTAATGTCACATGCAACATATTCATCAACAGC
TTTGGCTCTATCGCAGAGACGACCATGGATTACAGAGTGAATATCTTTCTTCGTCAGAAATGGAATGATCCCCGCCTCGC
GTACAGTGAATATCCTGACGACTCTTTAGACCTCGACCCCTCCATGTTGGACTCCATTTGGAAACCTGATTTGTTCTTTG
CCAATGAAAAGGGTGCCAACTTTCATGAAGTCACTACAGACAACAAATTGCTAAGAATTTTCAAAAATGGAAATGTTCTT
TATTCAATAAGATTAACATTAACACTTTCCTGTCCAATGGATCTCAAGAATTTTCCCATGGATGTACAAACATGTATAAT
GCAACTGGAAAGCTTTGGGTACACAATGAATGATCTCATTTTTGAATGGCAAGATGAGGCACCCGTACAAGTGGCAGAAG
GACTCACTTTGCCCCAGTTTCTGTTGAAAGAAGAAAAAGATTTACGATACTGCACTAAACATTACAATACAGGAAAGTTT
ACGTGTATAGAAGTGCGATTCCATCTGGAGCGACAAATGGGATACTATCTGATCCAGATGTACATTCCCAGTCTCCTGAT
TGTTATTCTATCCTGGGTTTCGTTCTGGATCAACATGGATGCAGCACCGGCCAGGGTAGCTCTGGGGATAACCACCGTGC
TAACGATGACTACACAGAGTTCAGGATCACGAGCTTCCTTGCCAAAAGTTTCATATGTCAAAGCTATTGATATTTGGATG
GCAGTATGCCTCCTTTTTGTGTTTTCAGCACTTCTGGAGTATGCAGCTGTAAATTTTGTATCAAGACAACACAAAGAACT
TCTGAGATTTCGACGAAAGAGAAAGAATAAGACAGAAGCCTTTGCACTGGAGAAGTTTTACCGTTTCTCAGATATGGATG
ATGAGGTAAGGGAAAGCCGATTCAGCTTCACAGCCTATGGAATGGGACCATGTCTACAAGCAAAGGATGGCATGACTCCA
AAGGGCCCCAACCACCCTGTCCAGGTAATGCCAAAAAGTCCTGATGAAATGAGGAAGGTCTTTATCGACCGGGCCAAGAA
GATTGATACCATCTCCCGAGCCTGCTTCCCATTAGCTTTTTTGATTTTTAATATTTTCTACTGGGTTATCTATAAAATTC
TTAGGCATGAGGATATTCATCAGCAGCAAGATACAGCTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTC
CTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNK4-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGACAACAGCTCCCCAGGAGCCCCCCGCCCGGCCCCTCCAGGCGGGCAGTGGAGCTGGCCCGGCGCCTGGGCGCGCCAT
GCGCAGCACCACGCTCCTGGCCCTGCTGGCGCTGGTCTTGCTTTACTTGGTGTCTGGTGCCCTGGTGTTCCGGGCCCTGG
AGCAGCCCCACGAGCAGCAGGCCCAGAGGGAGCTGGGGGAGGTCCGAGAGAAGTTCCTGAGGGCCCATCCGTGTGTGAGC
GACCAGGAGCTGGGCCTCCTCATCAAGGAGGTGGCTGATGCCCTGGGAGGGGGTGCGGACCCAGAAACCAACTCGACCAG
CAACAGCAGCCACTCAGCCTGGGACCTGGGCAGCGCCTTCTTTTTCTCAGGGACCATCATCACCACCATCGGCTATGGCA
ATGTGGCCCTGCGCACAGATGCCGGGCGCCTCTTCTGCATCTTTTATGCGCTGGTGGGGATTCCGCTGTTTGGGATCCTA
CTGGCAGGGGTCGGGGACCGGCTGGGCTCCTCCCTGCGCCATGGCATCGGTCACATTGAAGCCATCTTCTTGTGCCCAAC
TTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNIP1-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGGGGCCGTCATGGGCACCTTCTCATCTCTGCAAACCAAACAAAGGCGACCCTCGAAAGATAAGATTGAAGATGAGCT
GGAGATGACCATGGTTTGCCATCGGCCCGAGGGACTGGAGCAGCTCGAGGCCCAGACCAACTTCACCAAGAGGGAGCTGC
AGGTCCTTTATCGAGGCTTCAAAAATGAGTGCCCCAGTGGTGTGGTCAACGAAGACACATTCAAGCAGATCTATGCTCAG
TTTTTCCCTCATGGAGATGCCAGCACGTATGCCCATTACCTCTTCAATGCCTTCGACACCACTCAGACAGGCTCCGTGAA
GTTCGAGGACTTTGTAACCGCTCTGTCGATTTTATTGAGAGGAACTGTCCACGAGAAACTAAGGTGGACATTTAATTTGT
ATGACATCAACAAGGACGGATACATAAACAAAGAGGAGATGATGGACATTGTCAAAGCCATCTATGACATGATGGGGAAA
TACACATATCCTGTGCTCAAAGAGGACACTCCAAGGCAGCATGTGGACGTCTTCTTCCAGAAAATGGACAAAAATAAAGA
TGGCATCGTAACTTTAGATGAATTTCTTGAATCATGTCAGGAGGACGACAACATCATGAGGTCTCTCCAGCTGTTTCAAA
ATGTCATGTTGCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNA6-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

 

Single Cell Clones: 

Possibly C6

V5 Staining appears to be intracellular. Cell population is heterogenous

Sequence

ORF Sequence:

ATGAGATCGGAGAAATCCCTTACGCTGGCGGCGCCGGGGGAGGTCCGTGGGCCGGAGGGAGAGCAACAGGATGCGGGAGA CTTCCCGGAGGCCGGCGGGGGCGGGGGCTGCTGTAGTAGCGAGCGGCTGGTGATCAATATCTCCGGGCTGCGCTTTGAGA CACAATTGCGCACCCTGTCGCTGTTTCCGGACACGCTGCTCGGAGACCCTGGCCGGCGAGTCCGCTTCTTCGACCCCCTG AGGAACGAGTACTTCTTCGACCGCAACCGGCCCAGCTTCGACGCCATCCTCTACTACTACCAGTCTGGGGGCCGCCTGCG GAGGCCGGTCAACGTGCCCCTGGACATTTTCCTGGAGGAGATCCGCTTCTACCAGCTGGGGGACGAGGCCCTGGCGGCCT TCCGGGAGGACGAGGGCTGCCTGCCCGAAGGTGGCGAGGACGAGAAGCCGCTGCCCTCCCAGCCCTTCCAGCGCCAGGTG TGGCTGCTCTTTGAGTACCCAGAGAGCTCTGGGCCGGCCAGGGGCATCGCCATCGTCTCCGTGTTGGTCATTCTCATCTC CATAGTCATCTTTTGCCTGGAGACCTTACCCCAGTTCCGTGTAGATGGTCGAGGTGGAAACAATGGTGGTGTGAGTCGAG TCTCCCCAGTTTCCAGGGGGAGTCAGGAGGAAGAGGAGGATGAAGACGATTCCTACACATTTCATCATGGCATCACCCCT GGGGAAATGGGGACCGGGGGCTCCTCCTCACTCAGTACTCTTGGGGGCTCCTTCTTTACAGACCCCTTCTTTCTGGTGGA GACGCTGTGCATTGTCTGGTTCACTTTTGAGCTCCTGGTGCGCTTCTCCGCCTGCCCTAGCAAGCCGGCCTTCTTCCGGA ACATCATGAACATCATTGACTTGGTGGCTATCTTCCCCTACTTCATCACCCTGGGCACTGAGCTGGTGCAGCAGCAGGAG CAGCAACCAGCCAGTGGAGGAGGCGGCCAGAATGGGCAGCAGGCCATGTCCCTGGCCATCCTCCGAGTCATCCGCCTGGT CCGGGTGTTCCGCATCTTCAAGCTCTCCCGCCACTCCAAGGGGCTGCAGATCCTGGGCAAGACCTTGCAGGCCTCCATGA GGGAGCTGGGGCTGCTCATCTTCTTCCTCTTCATCGGGGTCATCCTCTTCTCCAGTGCCGTCTACTTCGCAGAGGCTGAC GATGACGATTCGCTTTTTCCCAGCATCCCGGATGCCTTCTGGTGGGCAGTGGTTACAATGACCACGGTAGGTTACGGGGA CATGTACCCCATGACTGTGGGGGGAAAGATCGTGGGCTCGCTGTGTGCCATCGCTGGGGTCCTCACCATTGCCCTGCCTG TGCCCGTCATCGTCTCCAACTTCAACTACTTCTACCACCGGGAGACGGAGCAGGAGGAGCAAGGCCAGTATACCCACGTC ACTTGTGGGCAGCCTGCGCCGGACCTGAGGGCAACTGACAACGGACTTGGCAAGCCTGACTTCCCCGAGGCTAACCGGGA ACGGAGACCCAGCTACCTTCCTACACCACATCGGGCCTATGCAGAGAAAAGAATGCTCACGGAGGTCTGCCCAACTTTCT TGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-PANX2-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGTACGTGCCCGCGCTGGGCTGGGAGTTCCTGGCCTCCACGCGCCTCACCTCCGAGCTCAACTTCCTGCTGCAGGAGAT
CGACAACTGTTACCACCGGGCGGCCGAGGGCCGCGCGCCCAAGATCGAGAAGCAGATCCAGTCCAAGGGCCCGGGCATCA
CGGAGCGCGAGAAGCGCGAGATCATCGAGAACGCGGAGAAGGAGAAGAGCCCGGAGCAGAACCTGTTCGAGAAGTACCTG
GAGCGCCGCGGCCGCAGCAACTTCCTGGCCAAGCTGTACCTGGCGCGGCACGTGCTGATCCTGCTGCTGAGCGCCGTGCC
CATCTCCTACCTGTGCACCTACTACGCCACGCAGAAGCAGAACGAGTTCACCTGCGCGCTGGGCGCGTCCCCGGACGGGG
CGGCAGGTGCGGGGCCCGCGGTGCGCGTGAGCTGCAAGCTCCCGTCCGTGCAACTGCAGCGCATCATCGCGGGCGTGGAC
ATCGTGCTGCTGTGCGTCATGAACCTCATCATCCTCGTCAACCTCATCCACCTCTTCATCTTCCGCAAGAGCAACTTCAT
CTTCGACAAGCTGCACAAGGTGGGCATCAAGACGCGCCGGCAGTGGCGCCGCTCGCAGTTCTGCGACATCAACATCCTGG
CCATGTTCTGCAACGAGAACCGCGACCACATCAAGTCGCTCAACCGGCTGGACTTCATCACCAACGAGAGCGACCTCATG
TACGACAACGTGGTCCGGCAGCTGCTGGCGGCGCTGGCGCAGTCCAACCACGACGCCACCCCCACGGTGCGCGACTCGGG
GGTGCAGACCGTGGACCCCAGCGCCAACCCCGCCGAGCCCGACGGCGCCGCCGAGCCGCCCGTGGTCAAGCGGCCGCGCA
AGAAGATGAAGTGGATCCCCACCAGCAACCCGCTTCCGCAGCCCTTCAAGGAGCCGCTGGCCATCATGCGCGTGGAGAAC
AGCAAGGCGGAGAAGCCGAAGCCCGCGCGCAGGAAGACGGCCACGGACACGCTGATCGCGCCGCTGCTGGACCGCTCCGC
CCACCACTACAAGGGCGGAGGGGGCGACCCGGGCCCCGGCCCCGCCCCTGCCCCCGCCCCGCCGCCCGCCCCCGACAAGA
AGCACGCGCGCCACTTCTCCCTGGACGTGCACCCCTACATCCTCGGCACCAAGAAGGCCAAGGCCGAGGCGGTGCCCGCC
GCCCTGCCCGCCTCCCGGAGCCAGGAGGGGGGCTTCCTGTCCCAGGCGGAGGACTGTGGGCTGGGCCTGGCCCCGGCGCC
CATCAAAGATGCTCCGCTCCCCGAGAAGGAAATCCCGTACCCCACAGAGCCAGCCCGGGCAGGGCTTCCCTCGGGGGGCC
CGTTCCACGTCCGCTCACCTCCCGCCGCCCCTGCTGTGGCCCCTCTGACACCAGCCAGCCTGGGCAAGGCGGAGCCCCTC
ACCATCCTGAGCCGAAACGCCACACACCCGCTGCTGCACATCAACACGCTGTACGAGGCCCGGGAGGAGGAGGACGGGGG
CCCCCGCCTGCCGCAGGACGTGGGGGACCTCATCGCCATCCCTGCCCCACAGCAGATCCTCATCGCCACCTTCGACGAGC
CGAGAACGGTCGTGAGTACTGTGGAGTTTCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTC
GGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-GRID1-isoform-1-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGAACAGCCTCATGGATGAAGACATTGCTCACAAGCAGATTTCCCCAGCGTCGATTGAGCTCTCGGCCCTGGAGATGGG
GGGCCTGGCTCCCACCCAGACCTTGGAGCCGACACGGGAGTACCAGAACACCCAGCTCTCGGTCAGCACCTTTCTGCCAG
AGCAGAGCAGCCATGGCACCAGCCGGACACTCTCATCAGGGCCCAGCAGCAACCTGCCGCTGCCGCTGAGCAGCTCGGCG
ACCATGCCCTCCATGCAGTGCAAACACAGGTCACCCAACGGGGGGCTGTTCCGGCAGAGCCCGGTGAAGACCCCCATCCC
CATGTCCTTCCAGCCCGTGCCTGGAGGCGTCCTTCCAGAGGCTCTGGACACCTCCCACGGGACCTCCATCTGCCCAACTT
TCTTGTACAAAGTGGTtggtaagcctatccctaaccctctcctcggtctcgattctacgtag

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNK7-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGGGGGTCTAAGGCCCTGGTCCCGATACGGGCTCCTGGTTGTGGCCCACTTGCTGGCCCTGGGGCTTGGGGCTGTGGT
GTTCCAGGCCCTGGAGGGGCCTCCTGCATGCAGGCTTCAGGCTGAGCTCAGGGCAGAGCTGGCAGCCTTCCAGGCAGAGC
ATAGGGCCTGCCTGCCACCCGGAGCTCTGGAAGAGCTGCTGGGCACTGCCCTGGCCACCCAGGCCCATGGGGTCTCCACC
CTGGGCAACAGCTCAGAGGGCAGGACCTGGGACCTTCCCTCAGCCCTGCTCTTCGCTGCCAGCATCCTCACCACCACAGG
TTATGGCCACATGGCCCCACTATCGCCAGGCGGAAAGGCCTTCTGCATGGTCTATGCAGCCCTGGGGCTGCCAGCCTCCT
TAGCTCTCGTGGCCACCCTGCGCCATTGCCTGCTGCCTGTGCTCAGCCGCCCACGTGCCTGGGTAGCGGTCCACTGGCAG
CTGTCACCGGCCAGGGCTGCGCTGCTGCAGGCAGTTGCACTGGGACTGCTGGTGGCCAGCAGCTTTGTGCTGCTGCCAGC
GCTGGTGCTGTGGGGCCTTCAGGGCGACTGCAGCCTGCTGGGGGCCGTCTACTTCTGCTTCAGCTCGCTCAGCACCATTG
GCCTGGAGGACTTGCTGCCCGGCCGCGGCCGCAGCCTGCACCCCGTGATTTACCACCTGGGCCAGCTCGCACTTCTTGGT
GGAGGGACCTCACTCCAGGGCACGGCGTGGGAGGGGACAGCTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCC
TCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNIP4-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGAATGTGGGGAGGGTGGAAAGCATTTCGGCTCAGCTGGAGGAGGCCAGCTCTACAGGCGGTTTCCTGTACGCTCAGAA
CAGCACCAAGCGCAGCATTAAAGAGCGGCTCATGAAGCTCTTGCCCTGCTCAGCTGCCAAAACGTCGTCTCCTGCTATTC
AAAACAGCGTGGAAGATGAACTGGAGATGGCCACCGTCAGGCATCGGCCCGAAGCCCTTGAGCTTCTGGAAGCCCAGAGC
AAATTTACCAAGAAAGAGCTTCAGATCCTTTACAGAGGATTTAAGAACGAATGCCCCAGTGGTGTTGTTAATGAAGAAAC
CTTCAAAGAGATTTACTCGCAGTTCTTTCCACAGGGAGACTCTACAACATATGCACATTTTCTGTTCAATGCATTTGATA
CAGACCACAATGGAGCTGTGAGTTTCGAGGATTTCATCAAAGGTCTTTCCATTTTGCTCCGGGGGACAGTACAAGAAAAA
CTCAATTGGGCATTTAATCTGTATGACATAAATAAAGATGGCTACATCACTAAAGAGGAAATGCTTGATATAATGAAAGC
AATATACGATATGATGGGTAAATGTACATATCCTGTCCTCAAAGAAGATGCTCCCAGACAACACGTTGAAACATTTTTTC
AGAAAATGGACAAAAATAAAGATGGGGTTGTTACCATAGATGAGTTCATTGAAAGCTGCCAAAAAGATGAAAACATAATG
CGCTCCATGCAGCTCTTTGAAAATGTGATTTACCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCT
CCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNA7-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGAGCCGCGGTGCCCGCCGCCGTGCGGCTGCTGCGAGCGGCTGGTGCTCAACGTGGCCGGGCTGCGCTTCGAGACGCG
GGCGCGCACGCTGGGCCGCTTCCCGGACACTCTGCTAGGGGACCCAGCGCGCCGCGGCCGCTTCTACGACGACGCGCGCC
GCGAGTATTTCTTCGACCGGCACCGGCCCAGCTTCGACGCCGTGCTCTACTACTACCAGTCCGGTGGGCGGCTGCGGCGG
CCGGCGCACGTGCCGCTCGACGTCTTCCTGGAAGAGGTGGCCTTCTACGGGCTGGGCGCGGCGGCCCTGGCACGCCTGCG
CGAGGACGAGGGCTGCCCGGTGCCGCCCGAGCGCCCCCTGCCCCGCCGCGCCTTCGCCCGCCAGCTGTGGCTGCTTTTCG
AGTTTCCCGAGAGCTCTCAGGCCGCGCGCGTGCTCGCCGTAGTCTCCGTGCTGGTCATCCTCGTCTCCATCGTCGTCTTC
TGCCTCGAGACGCTGCCTGACTTCCGCGACGACCGCGACGGCACGGGGCTTGCTGCTGCAGCCGCAGCCGGCCCGTTCCC
CGCTCGGCTGAATGGCTCCAGCCAAATGCCTGGAAATCCACCCCGCCTGCCCTTCAATGACCCGTTCTTCGTGGTGGAGA
CGCTGTGTATTTGTTGGTTCTCCTTTGAGCTGCTGGTACGCCTCCTGGTCTGTCCAAGCAAGGCTATCTTCTTCAAGAAC
GTGATGAACCTCATCGATTTTGTGGCTATCCTTCCCTACTTTGTGGCACTGGGCACCGAGCTGGCCCGGCAGCGAGGGGT
GGGCCAGCAGGCCATGTCACTGGCCATCCTGAGAGTCATCCGATTGGTGCGTGTCTTCCGCATCTTCAAGCTGTCCCGGC
ACTCAAAGGGCCTGCAAATCTTGGGCCAGACGCTTCGGGCCTCCATGCGTGAGCTGGGCCTCCTCATCTTTTTCCTCTTC
ATCGGTGTGGTCCTCTTTTCCAGCGCCGTCTACTTTGCCGAAGTTGACCGGGTGGACTCCCATTTCACTAGCATCCCTGA
GTCCTTCTGGTGGGCGGTAGTCACCATGACTACAGTTGGCTATGGAGACATGGCACCCGTCACTGTGGGTGGCAAGATAG
TGGGCTCTCTGTGTGCCATTGCGGGCGTGCTGACTATTTCCCTGCCAGTGCCCGTCATTGTCTCCAATTTCAGCTACTTT
TATCACCGGGAGACAGAGGGCGAAGAGGCTGGGATGTTCAGCCATGTGGACACGCAGCCTTGTGGCCCACTGGAGGGCAA
GGCCAATGGGGGGCTGGTGGACGGGGAGGTACCTGAGCTACCACCTCCACTCTGGGCACCCCCAGGGAAACACCTGGTCA
CCGAAGTGACAGCTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-PKD1L2-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGGGGAGGACTCTCCAGTGGCTATGTTCAGCTGGTATTTGGACAACACCCCAACAGAGCAGGCTGAGCCCCTCCCGGA
TGCCTGCAGACTCAGAGGATTTTGGCCAAGGTCCTTAACCCTCCTCCAGAGCAACACCTCCACGTTGCTGTTGAACAGCT
CGTTTCTGCAGTCCCGGGGAGAGGTCATCCGAATCAGAGCCACAGCACTGACCAGGCATGCCTATGGGGAGGACACCTAT
GTGATCAGCACTGTGCCTCCCCGTGAGGTGCCTGCCTGCACTATTGCCCCAGAGGAGGGCACCGTTCTGACGAGCTTTGC
CATCTTCTGCAACGCCTCCACAGCCCTGGGACCCCTGGAGTTCTGCTTCTGTCTGGAATCAGGTTCCTGCCTACACTGTG
GCCCTGAACCTGCCCTCCCATCAGTGTATCTGCCACTTGGAGAGGAGAACAATGACTTTGTGCTGACAGTAGTTATTTCT
GCCACCAATCGTGCAGGGGACACGCAGCAGACCCAGGCCATGGCTAAGGTGGCACTCGGAGACACATGTGTTGAGGATGT
AGCATTCCAGGCTGCCGTGTCAGAGAAAATCCCCACAGCTCTGCAAGGCGAGGGTGGCCCCGAGCAGCTCCTCCAGCTGG
CCAAGGCTGTGTCCTCCATGCTGAACCAAGAGCATGAAAGCCAGGGCTCAGGACAGTCACTGAGCATAGACGTCAGACAG
AAGGTCAGAGAGCATGTGCTGGGATCACTGTCTGCAGTCACCACCGGCTTGGAGGACGTGCAGAGGGTGCAGGAGCTGGC
CGAGGTGCTGAGAGAGGTGACCTGCCGGAGTAAGGAACTCACACCCTCGGCCCAGGGGTCCTGCATGGGCGATTCATGGG
AAGGTGCCCCTCCTGCTGCCCATGTATCTCACGCTAGGTGCCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCT
AACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-GRID1-isoform-2-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGTAGCGCTGACGCTGTGGCTTCTCCCCTGGATATGCCAGTGCGTGTCGGTGCGGGCCGACTCCATCATCCACATCGG
TGCCATCTTCGAGGAGAACGCGGCCAAGGACGACAGGGTGTTCCAGTTGGCGGTATCCGACCTGAGCCTCAACGATGACA
TCCTGCAGAGCGAGAAGATCACCTACTCCATCAAGGTCATCGAGGCCAACAACCCATTCCAGGCTGTGCAGGAAGCCTGT
GACCTCATGACCCAGGGGATTTTGGCCTTGGTCACGTCCACTGGCTGTGCATCTGCCAATGCCCTGCAGTCCCTCACGGA
TGCCATGCACATCCCACACCTCTTTGTCCAGCGCAACCCGGGAGGGTCGCCACGCACCGCATGCCACCTGAACCCCAGCC
CCGATGGTGAGGCCTACACACTGGCTTCGAGACCACCCGTCCGCCTCAATGATGTCATGCTCAGGCTGGTGACGGAGCTG
CGCTGGCAGAAGTTCGTCATGTTCTACGACAGCGAGTATGATATCCGTGGGCTTCAAAGCTTTCTGGACCAGGCCTCGCG
GCTGGGCCTTGACGTCTCTTTACAAAAGGTGGACAAGAACATTAGCCACGTATTCACCAGCCTCTTCACCACGATGAAGA
CAGAGGAGCTGAATCGCTACCGGGACACGCTTCGCCGCGCCATCCTGCTGCTCAGCCCACAGGGAGCCCACTCCTTCATC
AACGAGGCCGTGGAGACCAACCTGGCTTCCAAGGACAGCCACTGGGTCTTTGTGAATGAGGAAATCAGTGACCCGGAGAT
CCTGGATCTGGTCCATAGTGCCCTTGGAAGGATGACCGTGGTCCGGCAAATCTTTCCGTCTGCAAAGGACAATCAGAAAT
GCACGAGGAACAACCACCGCATCTCCTCCCTGCTCTGCGACCCCCAGGAAGGCTACCTCCAGATGCTGCAGATCTCCAAC
CTCTATCTGTATGACAGTGTTCTGATGCTGGCCAACGCCTTTCACAGGAAGCTGGAGGACCGGAAGTGGCATAGCATGGC
GAGCCTCAACTGCATACGGAAATCCACTAAGCCATGGAATGGTGGGAGGTCCATGCTGGATACCATCAAAAAGGGCCACA
TCACTGGCCTCACTGGGGTGATGGAGTTTCGGGAGGACAGTTCGAATCCCTATGTCCAGTTTGAAATCCTTGGCACTACC
TATAGTGAGACTTTTGGCAAAGACATGCGCAAGTTGGCGACATGGGACTCAGAGAAGGGCTTGAATGGCAGCTTGCAAGA
GAGGCCCATGGGCAGCCGCCTCCAAGGATTGACTCTTAAAGTGGTGACTGTCTTGGAAGAGCCTTTCGTGATGGTGGCTG
AGAACATCCTAGGACAGCCCAAGCGCTACAAAGGGTTCTCCATAGATGTCCTGGATGCACTGGCCAAGGCTCTGGGCTTT
AAATATGAGATTTACCAAGCCCCTGATGGCAGGTACGGTCACCAGCTCCATAACACCTCCTGGAACGGGATGATCGGGGA
GCTCATCAGCAAGAGAGCAGACTTGGCCATCTCTGCCATCACCATCACCCCAGAGAGGGAGAGCGTTGTGGACTTCAGCA
AGCGGTACATGGACTATTCAGTGGGGATTCTAATTAAGAAGCCCGAGGAGAAAATCAGCATCTTCTCCCTCTTTGCTCCA
TTTGATTTCGCTGTGTGGGCCTGCATTGCAGCAGCCATCCCTGTGGTTGGTGTGCTGATATTTGTGTTGAACAGGATACA
GGCTGTGAGGGCTCAGAGTGCTGCCCAGCCCAGGCCGTCAGCTTCTGCCACTCTGCACAGCGCCATCTACCCAACTTTCT
TGTACAAAGTGGTtggtaagcctatccctaaccctctcctcggtctcgattctacgtag

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNS1-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGCTGATGCTGCTGGTCCGGGGAACACACTATGAGAACCTCCGGTCTAAAGTGGTGCTGCCAACACCCCTAGGAGGGAG
GAGCACTGAAACCTTTGTGAGCGAGTTCCCGGGCCCCGACACCGGGATCCGCTGGCGGCGAAGCGACGAGGCGCTGCGCG
TGAACGTGGGTGGCGTGCGGCGGCAGCTGAGCGCGCGCGCCCTGGCGCGCTTCCCGGGCACGCGGCTGGGCCGCCTGCAG
GCCGCGGCGTCGGAGGAGCAGGCGCGGCGCCTGTGCGACGACTACGACGAGGCGGCGCGCGAATTCTACTTCGACCGGCA
CCCGGGCTTCTTCCTGAGCCTGCTGCACTTCTACCGCACTGGCCACCTGCACGTGCTCGACGAGCTGTGCGTCTTCGCCT
TTGGCCAGGAGGCCGACTACTGGGGCCTAGGCGAGAACGCGCTTGCCGCGTGCTGCCGCGCGCGCTACCTGGAGAGGCGG
CTGACCCAGCCGCACGCCTGGGACGAGGACAGCGACACGCCGAGCAGCGTGGACCCGTGCCCCGACGAGATCTCCGACGT
GCAGCGAGAACTGGCGCGCTATGGCGCGGCGCGCTGTGGCCGCCTGCGCCGCCGCCTCTGGCTGACCATGGAGAACCCGG
GCTACTCGCTGCCGAGCAAGCTCTTCAGCTGCGTCTCCATCAGCGTGGTGCTCGCCTCCATCGCCGCCATGTGCATCCAC
AGCCTGCCCGAGTACCAGGCCCGCGAGGCGGCGGCCGCCGTGGCTGCGGTGGCCGCGGGCCGCAGCCCGGAAGGCGTGCG
CGACGACCCGGTGCTGCGACGCCTCGAGTACTTCTGCATCGCCTGGTTCAGCTTCGAGGTGTCGTCGCGCCTCCTGCTGG
CGCCCAGTACGCGCAACTTCTTCTGCCACCCGCTCAACCTCATCGACATTGTGTCTGTGCTGCCCTTCTATCTCACGCTG
CTGGCTGGTGTGGCACTGGGCGACCAGGGCGGCAAGGAGTTCGGCCACCTGGGCAAGGTGGTGCAGGTGTTCCGCCTCAT
GCGCATCTTCCGCGTACTCAAGTTGGCGCGCCATTCCACCGGGCTGCGCTCGCTGGGAGCCACGCTCAAGCACAGCTACC
GTGAGGTGGGCATCTTGCTGCTGTACCTGGCTGTGGGTGTGTCAGTGTTCTCTGGTGTGGCCTACACAGCTGAAAAGGAG
GAGGACGTGGGCTTTAACACCATCCCAGCCTGCTGGTGGTGGGGCACAGTGAGCATGACCACCGTGGGCTATGGGGATGT
GGTGCCAGTGACGGTGGCTGGCAAGCTGGCAGCCTCAGGCTGCATCCTAGGGGGCATCCTGGTGGTAGCACTCCCCATCA
CCATCATCTTCAACAAGTTCTCCCACTTCTACCGGCGCCAGAAGGCTCTGGAGGCAGCCGTGCGCAACAGCAACCACCAA
GAGTTTGAGGACTTGCTGAGCAGCGTTGATGGGGTGTCGGAGGCATCTCTGGAGACATCCCGAGAAACCTCTCAGGAGGG
ACAGTCTGCAGATCTAGAGAGCCAGGCCCCCAGTGAGCCTCCACACCCTCAGATGTATACAGCTTTCTTGTACAAAGTGG
TTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNJ14-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGGCCTGGCCAGGGCCCTACGCCGCCTCAGCGGCGCCCTGGATTCGGGAGACAGCCGGGCGGGCGATGAAGAGGAGGC
CGGGCCCGGGTTGTGCCGCAACGGGTGGGCGCCGGCACCGGTGCAGTCACCCGTGGGCCGGCGCCGCGGTCGCTTCGTCA
AGAAAGACGGGCACTGCAACGTGCGTTTCGTAAACCTGGGTGGCCAGGGCGCGCGCTACCTGAGCGACCTGTTCACCACA
TGCGTGGACGTGCGCTGGCGCTGGATGTGCCTGCTCTTCTCCTGCTCCTTCCTCGCCTCCTGGCTGCTCTTCGGCCTGGC
CTTCTGGCTCATTGCCTCGCTGCACGGCGACCTGGCCGCCCCGCCACCGCCCGCGCCCTGCTTCTCACACGTGGCCAGCT
TCCTGGCCGCCTTCCTCTTCGCGCTGGAGACGCAGACGTCCATCGGCTACGGCGTGCGCAGCGTCACCGAGGAGTGCCCG
GCCGCTGTGGCCGCCGTGGTGCTGCAGTGCATTGCCGGCTGCGTGCTCGACGCCTTCGTCGTGGGTGCTGTCATGGCCAA
GATGGCCAAACCCAAGAAGCGCAACGAGACGCTGGTCTTCAGCGAGAACGCCGTCGTGGCGCTGCGCGACCACCGCCTCT
GCCTCATGTGGCGCGTCGGCAACCTGCGCCGCAGCCACCTGGTCGAGGCCCACGTGCGTGCCCAGCTGCTGCAGCCCCGT
GTGACCCCAGAGGGTGAGTACATCCCGCTGGACCACCAGGATGTGGATGTGGGCTTTGATGGAGGCACCGATCGTATCTT
CCTCGTGTCCCCCATCACCATCGTCCATGAGATCGACTCTGCCAGTCCTCTGTATGAGCTAGGACGTGCCGAGCTGGCCA
GGGCTGACTTTGAGCTGGTGGTCATTCTCGAGGGGATGGTTGAGGCCACAGCCATGACCACACAGTGTCGCTCGTCCTAC
CTCCCTGGTGAACTGCTCTGGGGCCATCGTTTTGAGCCAGTTCTCTTCCAGCGTGGCTCCCAGTATGAGGTCGACTATCG
CCACTTCCATCGCACTTATGAGGTCCCAGGGACACCGGTCTGCAGTGCTAAGGAGCTGGATGAACGGGCAGAGCAGGCTT
CCCACAGCCTCAAGTCTAGTTTCCCCGGCTCTCTGACTGCATTTTGTTATGAGAATGAACTTGCTCTGAGCTGCTGCCAG
GAGGAAGATGAGGACGATGAGACTGAGGAAGGGAATGGGGTGGAAACAGAAGATGGGGCTGCTAGCCCCCGAGTTCTCAC
ACCAACCCTGGCGCTGACCCTGCCTCCATGCCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCC
TCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNAB2-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGTATCCAGAATCAACGACGGGCTCCCCGGCTCGGCTCTCGCTGCGGCAGACGGGCTCCCCCGGGATGATCTACAGTAC
TCGGTATGGGAGTCCCAAAAGACAGCTCCAGTTTTACAGGAACCTGGGCAAGTCTGGCCTGCGGGTCTCCTGCCTGGGAC
TTGGAACATGGGTGACCTTCGGAGGCCAGATCACCGATGAGATGGCAGAGCAGCTCATGACCTTGGCCTATGATAATGGC
ATCAACCTCTTCGATACAGCAGAAGTCTACGCAGCCGGCAAGGCTGAAGTGGTACTGGGAAACATCATTAAGAAGAAAGG
ATGGAGGCGGTCCAGCCTCGTCATCACCACCAAGATCTTCTGGGGCGGAAAGGCGGAGACGGAGCGGGGCCTGTCCAGGA
AGCACATAATCGAAGGTCTGAAAGCTTCCCTGGAGCGACTGCAGCTGGAGTACGTGGATGTGGTGTTTGCCAACCGCCCG
GACCCCAACACCCCGATGGAAGAGACCGTCCGCGCCATGACCCACGTCATCAACCAGGGGATGGCCATGTACTGGGGCAC
GTCACGCTGGAGCTCCATGGAGATCATGGAGGCCTACTCCGTGGCCCGGCAGTTCAACCTGACCCCGCCCATCTGCGAGC
AGGCTGAGTACCACATGTTCCAGCGTGAGAAAGTGGAGGTGCAGCTGCCGGAGCTGTTCCACAAGATAGGAGTGGGCGCC
ATGACCTGGTCCCCTCTGGCCTGTGGCATTGTTTCTGGCAAGTACGACAGTGGCATCCCACCCTACTCAAGAGCCTCCTT
GAAGGGCTACCAGTGGCTGAAGGACAAGATCCTCAGTGAGGAGGGCCGGCGCCAGCAAGCCAAGCTGAAGGAGCTGCAGG
CCATCGCCGAGCGCCTGGGCTGCACCCTGCCCCAGCTGGCCATAGCCTGGTGCCTGAGGAATGAGGGAGTCAGCTCCGTG
CTCCTGGGGGCCTCCAATGCGGACCAGCTCATGGAGAACATTGGGGCAATACAGGTCCTTCCGAAACTGTCGTCTTCCAT
TATCCACGAGATTGATAGTATTTTGGGCAATAAACCCTACAGCAAAAAGGACTACAGATCCTTGCCAACTTTCTTGTACA
AAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-PKD2L2-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGCTGAGGCGTCACGGTGGCACCGAGGCGGGGCTTCGAAACATAAGTTGCATTACAGAAAGGAAGTAGAAATTACAAC
CACACTTCAGGAATTGTTACTCTACTTTATTTTTTTAATAAACCTATGTATATTGACTTTTGGGATGGTAAACCCACATA
TGTATTACTTAAACAAGGTTATGTCATCTCTATTTTTGGACACTTCTGTGCCTGGTGAAGAAAGAACCAACTTTAAGTCC
ATTCGCAGCATAACTGATTTTTGGAAGTTTATGGAAGGACCCCTTTTGGAAGGTCTGTACTGGGATTCATGGTACAATAA
CCAGCAGCTGTATAATTTAAAGAACAGCAGTCGCATCTACTATGAAAATATACTTCTAGGAGTTCCCAGAGTTCGTCAAC
TAAAAGTCCGCAACAACACATGCAAAGTCTATTCATCTTTTCAGTCTTTGATGAGTGAATGTTATGGCAAATATACTTCT
GCAAATGAAGACCTCTCTAATTTTGGCCTTCAAATTAATACTGAATGGAGATATTCTACTTCTAATACCAACTCCCCTTG
GCACTGGGGATTTCTTGGTGTTTACCGAAATGGGGGATACATTTTCACTTTATCAAAATCGAAATCTGAAACCAAAAACA
AGTTCATTGACCTTCGACTGAACAGCTGGATCACAAGAGGGACTAGAGTTATTTTTATTGATTTTTCCTTATATAATGCT
AATGTAAATCTATTTTGTATTATCAGATTGGTGGCAGAATTCCCTGCAACTGGAGGAATACTTACTTCATGGCAGTTTTA
CTCTGTGAAGCTCCTCAGATATGTTAGCTACTATGACTATTTTATTGCTTCCTGTGAAATCACATTCTGTATTTTTCTTT
TTGTCTTCACAACACAAGAAGTCAAAAAAATAAAAGAATTTAAGTCTGCCTATTTCAAAAGTATTTGGAACTGGCTAGAA
TTGCTACTTTTGCTGTTGTGTTTTGTGGCTGTTTCCTTCAACACATACTATAATGTACAAATTTTTCTCTTACTTGGACA
GCTGTTGAAAAGTACTGAAAAATATTCAGATTTCTATTTTCTTGCATGCTGGCACATTTATTACAATAATATAATTGCTA
TTACCATCTTTTTTGCATGGATAAAGAATATGTTCTTGGCAATTATTAATGATACCTATTCTGAAGTGAAAGCTGACTAT
TCAATAGGCAGAAGGCCAGATTTTGAACTTGGCAAAATGATTAAACAGAGTTACAAAAATGTTCTCGAGAAATTCAGACT
GAAGAAAGCTCAAAAAGATGAAGACAAGAAAACCAAAGGCAGCGGAGATTTGGCTGAACAAGCCAGAAGAGAAGGCTTTG
ACGAAAATGAGATTCAAAACGCAGAGCAGATGAAAAAATGGAAAGAGAGGCTTGAGAAAAAGTATTATTCTATGGAAATT
CAAGATGACTACCAGCCTGTCACTCAAGAAGAATTTCGAGAACTTTTTTTATATGCTGTGGAGCTGGAGAAGGAATTACA
CTACATCAATTTGAAGCTAAATCAAGTGGTGAGAAAGGTTTCAGCTCTATACCCAACTTTCTTGTACAAAGTGGTTGGTA
AGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-HTR3C-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGAAGGAGGGTGGCCTGCAAGGCAGAGTGCCCTCCTCTGCCTCACTGTCAGTCTTCTGCTTCAAGGAAGAGGCGACGC
TTTTACCATCAATTGCTCAGGCTTTGACCAGCATGGGGTTGACCCTGCTGTCTTCCAAGCAGTGTTTGACAGAAAGGCCT
TCCGTCCATTCACCAACTACAGCATCCCTACCCGTGTCAACATCTCCTTCACCCTGTCTGCCATCCTGGGAGTGGATGCA
CAGCTCCAGCTGCTGACATCATTCCTGTGGATGGATTTGGTATGGGACAATCCTTTCATTAATTGGAACCCAAAAGAGTG
TGTTGGCATCAATAAACTCACAGTATTAGCTGAAAACCTGTGGCTCCCAGACATCTTCATCGTGGAATCCATGGATGTGG
ATCAGACGCCTTCCGGTCTCACTGCCTATATCAGCAGTGAAGGTCGAATTAAGTATGATAAGCCAATGAGGGTGACCAGC
ATCTGTAACCTGGACATCTTCTACTTCCCTTTTGACCAACAGAACTGTACCTTCACCTTCAGTTCTTTCCTCTACACAGT
GGACAGCATGCTGCTGGGCATGGACAAGGAGGTGTGGGAGATCACAGACACGTCTCGCAAAGTCATCCAAACCCAGGGGG
AGTGGGAGCTCTTGGGCATCAACAAGGCCACCCCAAAGATGTCCATGGGCAACAACCTATATGACCAGATCATGTTTTAT
GTGGCCATCAGGCGCAGGCCAAGCCTCTACATCATAAACCTGCTGGTGCCCAGTAGCTTTCTGGTTGCCATTGATGCCCT
CAGCTTCTACCTGCCAGCAGAGAGCGAGAATCGTGCCCCATTCAAGATAACACTTCTGCTGGGCTACAACGTCTTCCTGC
TCATGATGAATGACTTGCTCCCTGCCAGTGGCACCCCCCTCATCAGTGTCTACTTCGCCCTGTGCCTGTCCCTGATGGTG
GTCAGCCTGCTGGAGACCGTCTTCATTACCTACCTGCTGCACGTGGCCACCACCCAGCCCCCACCCATGCCTAGGTGGCT
TCACTCCCTGCTGCTCCACTGCACCAGCCCAGGGAGATGCTGTCCCACTGCGCCCCAGAAGGGAAATAAGGGCCTGGGTC
TCACCCTCACCCACCTGCCTGGCCCAAAGGAGCCGGGGGAGTTAGCAGGGAAGAAGCTGGGACCCAGAGAGACCGAGCCA
GATGGGGGCTCAGGATGGACAAAGACCCAGCTAATGGAGCTGTGGGTGCAGTTCAGCCACGCGATGGACACCCTGCTCTT
CCGCCTCTACCTGCTCTTCATGGCCTCCTCCATCCTTACTGTCATTGTCCTCTGGAACACCTTGCCAACTTTCTTGTACA
AAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNS2-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGACCGGCCAGAGCCTGTGGGACGTGTCGGAGGCTAACGTCGAGGACGGGGAGATCCGCATCAATGTGGGCGGCTTCAA
GAGGAGGCTGCGCTCGCACACGCTGCTGCGCTTCCCCGAGACGCGCCTGGGCCGCTTGCTGCTCTGCCACTCGCGCGAGG
CCATTCTGGAGCTCTGCGATGACTACGACGACGTCCAGCGGGAGTTCTACTTCGACCGCAACCCTGAGCTCTTCCCCTAC
GTGCTGCATTTCTATCACACCGGCAAGCTTCACGTCATGGCTGAGCTATGTGTCTTCTCCTTCAGCCAGGAGATCGAGTA
CTGGGGCATCAACGAGTTCTTCATTGACTCCTGCTGCAGCTACAGCTACCATGGCCGCAAAGTAGAGCCCGAGCAGGAGA
AGTGGGACGAGCAGAGTGACCAGGAGAGCACCACGTCTTCCTTCGATGAGATCCTTGCCTTCTACAACGACGCCTCCAAG
TTCGATGGGCAGCCCCTCGGCAACTTCCGCAGGCAGCTGTGGCTGGCGCTGGACAACCCCGGCTACTCAGTGCTGAGCAG
GGTCTTCAGCATCCTGTCCATCCTGGTGGTGATGGGGTCCATCATCACCATGTGCCTCAATAGCCTGCCCGATTTCCAAA
TCCCTGACAGCCAGGGCAACCCTGGCGAGGACCCTAGGTTCGAAATCGTGGAGCACTTTGGCATTGCCTGGTTCACATTT
GAGCTGGTGGCCAGGTTTGCTGTGGCCCCTGACTTCCTCAAGTTCTTCAAGAATGCCCTAAACCTTATTGACCTCATGTC
CATCGTCCCCTTTTACATCACTCTGGTGGTGAACCTGGTGGTGGAGAGCACACCTACTTTAGCCAACTTGGGCAGGGTGG
CCCAGGTCCTGAGGCTGATGCGGATCTTCCGCATCTTAAAGCTGGCCAGGCACTCCACTGGCCTCCGCTCCCTGGGGGCC
ACTTTGAAATACAGCTACAAAGAAGTAGGGCTGCTCTTGCTCTACCTCTCCGTGGGGATTTCCATCTTCTCCGTGGTGGC
CTACACCATTGAAAAGGAGGAGAACGAGGGCCTGGCCACCATCCCTGCCTGCTGGTGGTGGGCTACCGTCAGTATGACCA
CAGTGGGGTACGGGGATGTGGTCCCAGGGACCACGGCAGGAAAGCTGACTGCCTCTGCCTGCATCTTGGCAGGCATCCTC
GTGGTGGTCCTGCCCATCACCTTGATCTTCAATAAGTTCTCCCACTTTTACCGGCGCCAAAAGCAACTTGAGAGTGCCAT
GCGCAGCTGTGACTTTGGAGATGGAATGAAGGAGGTCCCTTCGGTCAATTTAAGGGACTATTATGCCCATAAAGTTAAAT
CCCTTATGGCAAGCCTGACGAACATGAGCAGGAGCTCACCAAGTGAACTCAGTTTAAATGATTCCCTACGTTACCAAACT
TTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNJ15-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

 

Single Cell Clones:

F8-- Heterogenous expression of V5 across few positive cells. 

Sequence

ORF Sequence:

ATGGATGCCATTCACATCGGCATGTCCAGCACCCCCCTGGTGAAGCACACTGCTGGGGCTGGGCTCAAGGCCAACAGACC CCGCGTCATGTCCAAGAGTGGGCACAGCAACGTGAGAATTGACAAAGTGGATGGCATATACCTACTCTACCTGCAAGACC TGTGGACCACAGTTATCGACATGAAGTGGAGATACAAACTCACCCTGTTCGCTGCCACTTTTGTGATGACCTGGTTCCTT TTTGGAGTCATCTACTATGCCATCGCGTTTATTCATGGGGACTTAGAACCCGGTGAGCCCATTTCAAATCATACCCCCTG CATCATGAAAGTGGACTCTCTCACTGGGGCGTTTCTCTTTTCCCTGGAATCCCAGACAACCATTGGCTATGGAGTCCGTT CCATCACAGAGGAATGTCCTCATGCCATCTTCCTGTTGGTTGCTCAGTTGGTCATCACGACCTTGATTGAGATCTTCATC ACCGGAACCTTCCTGGCCAAAATCGCCAGACCCAAAAAGCGGGCTGAGACCATCAAGTTCAGCCACTGTGCAGTCATCAC CAAGCAGAATGGGAAGCTGTGCTTGGTGATTCAGGTAGCCAATATGAGGAAGAGCCTCTTGATTCAGTGCCAGCTCTCTG GCAAGCTCCTGCAGACCCACGTCACCAAGGAGGGGGAGCGGATTCTCCTCAACCAAGCCACTGTCAAATTCCACGTGGAC TCCTCCTCTGAGAGCCCCTTCCTCATTCTGCCCATGACATTCTACCATGTGCTGGATGAGACGAGCCCCCTGAGAGACCT CACACCCCAAAACCTAAAGGAGAAGGAGTTTGAGCTTGTGGTCCTCCTCAATGCCACTGTGGAATCCACCAGCGCTGTCT GCCAGAGCCGAACATCTTATATCCCAGAGGAAATCTACTGGGGTTTTGAGTTTGTGCCTGTGGTATCTCTCTCCAAAAAT GGAAAATATGTGGCTGATTTCAGTCAGTTTGAACAGATTCGGAAAAGCCCAGATTGCACATTTTACTGTGCAGATTCTGA GAAACAGCAACTCGAGGAGAAGTACAGGCAGGAGGATCAGAGGGAAAGAGAACTGAGGACACTTTTATTACAACAGAGCA ATGTCTGCCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNAB3-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGCAGGTGTCTATCGCGTGTACCGAGCAGAACCTTCGCAGCCGGAGCAGTGAGGACCGTCTGTGTGGACCCCGGCCGGG
CCCCGGGGGCGGTAATGGTGGGCCGGCCGGCGGGGGGCACGGGAATCCTCCGGGGGGTGGAGGGTCTGGCCCCAAGGCCC
GAGCTGCACTGGTTCCCCGACCCCCAGCGCCCGCTGGGGCCCTCCGAGAGAGCACCGGCCGAGGCACTGGCATGAAATAC
AGGAACCTAGGGAAGTCTGGTCTTCGGGTATCCTGTCTTGGCCTAGGTACCTGGGTCACATTTGGTTCTCAGATCTCAGA
TGAGACAGCAGAGGATGTGCTGACTGTAGCCTATGAGCATGGTGTAAACCTGTTTGACACCGCCGAAGTGTACGCAGCAG
GAAAGGCTGAAAGAACCCTAGGGAACATCCTCAAGAGCAAAGGTTGGAGGAGATCAAGCTATGTCATCACTACCAAGATT
TTTTGGGGAGGACAGGCAGAAACCGAGCGAGGTTTAAGCCGAAAGCACATCATTGAGGGCTTGCGAGGATCCCTGGAACG
CCTCCAGCTGGGATACGTGGACATTGTCTTTGCCAATCGCTCAGACCCCAACTGTCCTATGGAGGAGATTGTGCGAGCCA
TGACCTATGTCATCAACCAGGGCCTGGCCCTATACTGGGGGACATCCCGATGGGGGGCTGCAGAAATCATGGAGGCCTAC
TCCATGGCCAGACAGTTCAATCTGATTCCTCCAGTGTGTGAACAAGCGGAGCACCATCTGTTTCAGAGGGAGAAGGTGGA
GATGCAGCTGCCAGAGCTCTACCACAAGATTGGAGTTGGATCAGTCACTTGGTACCCTCTAGCCTGTGGTCTCATTACTA
GCAAGTATGATGGGCGAGTCCCAGATACTTGCAGGGCCTCCATCAAGGGCTACCAGTGGCTCAAGGACAAAGTGCAGAGT
GAAGATGGCAAGAAGCAACAAGCCAAAGTCATGGACCTTCTTCCTGTCGCTCACCAGCTGGGCTGCACCGTGGCCCAGCT
TGCTATTGCGTGGTGTCTCCGCAGTGAGGGTGTCAGCTCTGTCTTGCTGGGGGTGTCGAGTGCGGAGCAGTTGATAGAAC
ACCTGGGCGCGCTACAGGTGCTGAGCCAGCTGACCCCGCAGACAGTGATGGAAATAGACGGGCTCCTGGGAAACAAGCCG
CATTCCAAGAAGTTGCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTAC
GTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-HTR3D-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGTGGCCATCAGGCGCAGGTGCAGGCCCAGCCCCTACGTGGTAAACTTTCTGGTGCCCAGTGGCATTCTGATTGCCATCGATGCCCTCAGTTTCTACCTGCCACTGGAAAGTGGGAATTGTGCCCCATTCAAGATGACTGTTCTGCTGGGCTACAGCG TCTTCCTGCTCATGATGAATGACTTGCTCCCAGCCACTAGCACTTCATCACATGCTTCACTAGTACGTCCTCATCCATCA AGAGACCAAAAGCGAGGTGTCTACTTCGCCCTGTGCCTGTCCCTGATGGTGGGCAGCCTGCTGGAGACCATCTTCATCACCCACCTGCTGCACGTGGCCACCACCCAGCCCCTACCTCTGCCTCGGTGGCTCCACTCCCTGCTGCTGCACTGCACCGGCCAAGGGAGATGCTGTCCCACTGCGCCCCAGAAGGGAAATAAGGGCCCGGGTCTCACCCCCACCCACCTGCCCGGTGTGAAGGAGCCAGAGGTATCAGCAGGGCAGATGCCAGGCCCTGGGGAGGCAGAGCTGACAGGGGGCTCAGAATGGACAAGGGCCCAGCGGGAACACGAGGCCCAGAAGCAGCACTCGGTGGAGCTGTGGGTGCAGTTCAGCCACGCGATGGACGCCCTGCTCTTCCGCCTCTACCTGCTCTTCATGGCCTCCTCCATCATCACCGTCATATGCCTCTGGAACACCTTGCCAACTTTCTTGTACAAA GTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNS3-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGTGTTTGGTGAGTTTTTCCATCGCCCTGGACAAGACGAGGAACTTGTCAACCTGAATGTGGGGGGCTTTAAGCAGTC
TGTTGACCAAAGCACCCTCCTGCGGTTTCCTCACACCAGACTGGGGAAGCTGCTTACTTGCCATTCTGAAGAGGCCATTC
TGGAGCTGTGTGATGATTACAGTGTGGCCGATAAGGAATACTACTTTGATCGGAATCCCTCCTTGTTCAGATATGTTTTG
AATTTTTATTACACGGGGAAGCTGCATGTCATGGAGGAGCTGTGCGTATTCTCATTCTGCCAGGAGATCGAGTACTGGGG
CATCAACGAGCTCTTCATTGATTCTTGCTGCAGCAATCGCTACCAGGAACGCAAGGAGGAAAACCACGAGAAGGACTGGG
ACCAGAAAAGCCATGATGTGAGTACCGACTCCTCGTTTGAAGAGTCGTCTCTGTTTGAGAAAGAGCTGGAGAAGTTTGAC
ACACTGCGATTTGGTCAGCTCCGGAAGAAAATCTGGATTAGAATGGAGAATCCAGCGTACTGCCTGTCCGCTAAGCTTAT
CGCTATCTCCTCCTTGAGCGTGGTGCTGGCCTCCATCGTGGCCATGTGCGTTCACAGCATGTCGGAGTTCCAGAATGAGG
ATGGAGAAGTGGATGATCCGGTGCTGGAAGGATTGGAGATCGCGTGCATTGCCTGGTTCACCGGGGAGCTTGCCGTCCGG
CTGGCTGCCGCTCCTTGTCAAAAGAAATTCTGGAAAAACCCTCTGAACATCATTGACTTTGTCTCTATTATTCCCTTCTA
TGCCACGTTGGCTGTAGACACCAAGGAGGAAGAGAGTGAGGATATTGAGAACATGGGCAAGGTGGTCCAGATCCTACGGC
TTATGAGGATTTTCCGAATTCTAAAGCTTGCCCGGCACTCGGTAGGACTTCGGTCTCTAGGTGCCACACTGAGACACAGC
TACCATGAAGTTGGGCTTCTGCTTCTCTTCCTCTCTGTGGGCATTTCCATTTTCTCTGTGCTTATCTACTCCGTGGAGAA
AGATGACCACACATCCAGCCTCACCAGCATCCCCATCTGCTGGTGGTGGGCCACCATCAGCATGACAACTGTGGGCTATG
GAGACACCCACCCGGTCACCTTGGCGGGAAAGCTCATCGCCAGCACATGCATCATCTGTGGCATCTTGGTGGTGGCCCTT
CCCATCACCATCATCTTCAACAAGTTTTCCAAGTACTACCAGAAGCAAAAGGACATTGATGTGGACCAGTGCAGTGAGGA
TGCACCAGAGAAGTGTCATGAGCTACCTTACTTTAACATTAGGGATATATATGCACAGCGGATGCACGCCTTCATTACCA
GTCTCTCTTCTGTAGGCATTGTGGTGAGCGATCCTGACTCCACAGATGCTTCAAGCATTGAAGACAATGAGGACATTTGT
AACACCACCTCCTTGGAGAATTGCACAGCAAAATGCCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCC
TCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-GABRR1-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGAGATTTGGCATCTTTCTTTTGTGGTGGGGATGGGTTTTGGCCACTGAAAGCAGAATGCACTGGCCCGGAAGAGAAGT CCACGAGATGTCTAAGAAAGGCAGTAGGCCCCAAAGACAAAGACGAGAAGTACATGAAGATGCCCACAAGCAAGTCAGCC CAATTCTGAGACGAAGTCCTGACATCACCAAATCGCCTCTGACAAAGTCAGAACAGCTTCTGAGGATAGATGACCATGAT TTCAGCATGAGGCCTGGCTTTGGAGGCCCTGCCATTCCTGTTGGTGTGGATGTGCAGGTGGAGAGTTTGGATAGCATCTC AGAGGTTGACATGGACTTTACGATGACCCTCTACCTGAGGCACTACTGGAAGGACGAGAGGCTGTCTTTTCCAAGCACCA ACAACCTCAGCATGACGTTTGATGGCCGGCTGGTCAAGAAGATCTGGGTCCCTGACATGTTTTTCGTGCACTCCAAACGC TCCTTCATCCACGACACCACCACAGACAACGTCATGTTGCGGGTCCAGCCTGATGGGAAAGTGCTCTATAGTCTCAGGGT TACAGTAACTGCAATGTGCAACATGGACTTCAGCCGATTTCCCTTGGACACACAAACGTGCTCTCTTGAAATTGAAAGCT ATGCCTATACAGAAGATGACCTCATGCTGTACTGGAAAAAGGGCAATGACTCCTTAAAGACAGATGAACGGATCTCACTC TCCCAGTTCCTCATTCAGGAATTCCACACCACCACCAAACTGGCTTTCTACAGCAGCACAGGCTGGTACAACCGTCTCTA CATTAATTTCACGTTGCGTCGCCACATCTTCTTCTTCTTGCTCCAAACTTATTTCCCCGCTACCCTGATGGTCATGCTGT CCTGGGTGTCCTTCTGGATCGACCGCAGAGCCGTGCCTGCCAGAGTCCCCTTAGGTATCACAACGGTGCTGACCATGTCC ACCATCATCACGGGCGTGAATGCCTCCATGCCGCGCGTCTCCTACATCAAGGCCGTGGACATCTACCTCTGGGTCAGCTT TGTGTTCGTGTTCCTCTCGGTGCTGGAGTATGCGGCCGTCAACTACCTGACCACTGTGCAGGAGAGGAAGGAACAGAAGC TGCGGGAGAAGCTTCCCTGCACCAGCGGATTACCTCCGCCCCGCACTGCAATGCTGGACGGCAACTACAGTGATGGGGAG GTGAATGACCTGGACAACTACATGCCAGAGAATGGAGAGAAGCCCGACAGGATGATGGTGCAGCTGACCCTGGCCTCAGA GAGGAGCTCCCCACAGAGGAAAAGTCAGAGAAGCAGCTATGTGAGCATGAGAATCGACACCCACGCCATTGATAAATACT CCAGGATCATCTTTCCAGCAGCATACATTTTATTCAATTTAATATACTGGTCTATTTTCTCCTTGCCAACTTTCTTGTAC AAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNK12-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

atgtcctcccgcagcccccggcccccgccccgccgtagccgccgccgcctgccgcgcccctcctgctgctgctgctgctg
ccgccgttcgcacctcaacgaggacaccggccgcttcgtgctgctggcggcgctcatcggcctctacctggtggcgggtg
ccacagtcttctcggcgctcgagagccccggcgaggcggaggcgcgggcgcgctggggcgccacgctgcgcaacttcagc
gctgcgcacggcgtggccgagccagagctgcgcgccttcctccggcactacgaggccgcgctggccgccggcgtccgcgc
cgacgcgctgcgcccgcgctgggacttccccggcgccttctacttcgtgggcaccgtggtgtcaaccataggtttcggca
tgaccacccccgcgacggtgggcgggaaggccttcctcatcgcctacgggctgttcggctgcgctgggaccatcctgttc
ttcaacctcttcctggagcgcatcatctcgctgctggccttcatcatgcgcgcctgccgggagcgccagctgcgccgcag
cggcctgctgcccgccaccttccgccgcggctccgcgctctcggaggccgacagcctggcgggctggaagccctcggtgt
accacgtgctgctcatcctgggcctgttcgccgtgctgctgtcctgctgcgcctcggccatgtacaccagcgtggagggc
tgggactacgtggactcgctctacttctgcttcgtcaccttcagcaccatcggcttcggggacctggtgagcagccagca
cgccgcctaccggaaccaggggctctaccgcctgggcaacttcctcttcatcctgctcggcgtgtgctgcatttactcgc
tcttcaacgtcatctccatcctcatcaagcaggtgctcaactggatgctgcgcaagctgagctgccgctgctgcgcgcgc
tgctgcccggctcctggcgcgcccctggcccggcgcaatgccatcaccccaggctcccggctgcgccgccgcctggccgc
gctcggcgccgaccccgcggcccgcgacagcgacgccgagggccgccgcctctcgggcgagctcatctccatgcgcgacc
tcacggcctccaacaaggtgtcgctggcgctgctgcagaagcagctgtcggagacggccaacggctacccgcgcagcgtg
tgcgtcaacacgcgccagaacggcttctcgggcggcgtgggcgcgctgggcatcatgaacaaccggctggccgagaccag
cgcctccaggACAGCTTTCTTGTACAAAGTGGTtggtaagcctatccctaaccctctcctcggtctcgattctacgtag

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-KCNG4-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGCCCATGCCTTCCAGAGACGGGGGCCTGCATCCCAGACACCACCACTATGGTTCCCACAGCCCTTGGAGTCAGCTCCT
GTCCAGCCCCATGGAGACGCCGTCCATCAAGGGCCTTTACTACCGGAGGGTGCGGAAGGTGGGTGCCCTGGACGCCTCCC
CAGTGGACCTGAAGAAGGAGATCCTGATCAACGTGGGGGGCAGGAGGTATCTCCTCCCCTGGAGCACACTGGACCGGTTC
CCGCTGAGCCGCCTGAGCAAACTCAGGCTCTGTCGGAGCTACGAGGAGATCGTGCAGCTCTGCGATGATTACGACGAGGA
CAGCCAGGAGTTCTTCTTCGACAGGAGCCCCAGCGCCTTCGGGGTGATCGTGAGCTTCCTGGCGGCCGGGAAGCTGGTGC
TTCTGCAGGAGATGTGCGCGCTGTCCTTCCAGGAGGAGCTGGCCTACTGGGGCATCGAGGAGGCCCACCTGGAGAGGTGC
TGCCTGCGGAAGCTGCTGAGGAAGCTGGAGGAGCTGGAGGAGCTGGCCAAGCTGCACAGGGAGGACGTACTGAGGCAGCA
GAGGGAGACCCGCCGCCCCGCCTCGCACTCCTCGCGCTGGGGCCTGTGCATGAACCGGCTGCGCGAGATGGTGGAAAACC
CGCAGTCCGGGCTGCCCGGGAAGGTCTTCGCTTGCCTCTCCATCCTCTTCGTGGCCACCACAGCCGTCAGCCTGTGTGTC
AGCACCATGCCCGACCTCAGGGCAGAGGAGGACCAGGTGAGCGGCCTCTGCCCAACTTTCTTGTACAAAGTGGTTGGTAA
GCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-HTR3E-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

 

Single Cell Clones:

E3, F4, F6. Majority of cells are expressing V5 at very low intensity.  

 

Sequence

ORF Sequence:

atgtctgccatcctagatgtgaatgaacagctgcacctcttgtcatcattcctgtggctggaaatggtttgggataaccc atttatcagctggaacccagaggaatgtgagggcatcacgaagatgagtatggcagccaagaacctgtggctcccagaca ttttcatcattgaactcatggatgtggataagaccccaaaaggcctcacagcatatgtaagtaatgaaggtcgcatcagg tataagaaacccatgaaggtggacagtatctgtaacctggacatcttctacttccccttcgaccagcagaactgcacact caccttcagctcattcctctacacagtggacagcatgttgctggacatggagaaagaagtgtgggaaataacagacgcat cccggaacatccttcagacccatggagaatgggagctcctgggcctcagcaaggccaccgcaaagttgtccagggtggcc atcaggcgcaggcccagcctctatgtcataaaccttctcgtgcccagtggctttctggttgccatcgatgccctcagctt ctacctgccagtgaaaagtgggaatcgtgtcccattcaagataacgctcctgctgggctacaacgtcttcctgctcatga tgagtgacttgctccccaccagtggcacccccctcatcggtgtctacttcgccctgtgcctgtccctgatggtgggcagc ctgctggagaccatcttcatcacccacctgctgcacgtggccaccacccagcccccacccctgcctcggtggctccactc cctgctgctccactgcaacagcccggggagatgctgtcccactgcgccccagaaggaaaataagggcccgggtctcaccc ccacccacctgcccggtgtgaaggagccagaggtatcagcagggcagatgccgggccctgcggaggcagagctgacaggg ggctcagaatggacaagggcccagcgggaacacgaggcccagaagcagcactcagtggagctgtggttgcagttcagcca cgcgatggacgccatgctcttccgcctctacctgctcttcatggcctcctctatcatcaccgtcatatgcctctggaaca ccTTGCCAACTTTCTTGTACAAAGTGGTtggtaagcctatccctaaccctctcctcggtctcgattctacgtag

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-LRRC55-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGCTCAGAAGCCCCACCTTCACAGACGCTGGCCCCAGATGTAGCTGCCTTCCTGTGTCACAGACTCTCGATTCCATGGA
CACAGTCCTCATGGGCTCCCTCCAGCACTGCTGTTGCCTGCTGCCTAAGATGGGTGACACTTGGGCCCAGCTTCCCTGGC
CCGGGCCACCCCACCCAGCAATGCTGCTGATCTCCCTCCTCTTGGCAGCCGGGTTGATGCACTCGGATGCCGGCACCAGC
TGCCCCGTCCTTTGCACATGCCGTAACCAGGTGGTGGATTGTAGCAGCCAGCGGCTATTCTCCGTGCCCCCAGACCTGCC
AATGGACACCCGAAACCTCAGCCTGGCCCACAACCGCATCACAGCAGTGCCGCCTGGCTACCTCACATGCTACATGGAGC
TCCAGGTGCTGGATTTGCACAACAACTCCTTAATGGAGCTGCCCCGGGGCCTCTTCCTCCATGCCAAGCGCTTGGCACAC
TTGGACCTGAGCTACAACAATTTCAGCCATGTGCCAGCCGACATGTTCCAGGAGGCCCATGGGCTAGTCCACATCGACCT
GAGCCACAACCCCTGGCTGCGGAGGGTGCATCCCCAGGCCTTTCAGGGCCTCATGCAGCTCCGAGACCTGGACCTCAGTT
ATGGGGGCCTGGCCTTCCTCAGCCTGGAGGCTCTTGAGGGCCTACCGGGGCTGGTGACCCTGCAGATCGGTGGCAATCCC
TGGGTGTGTGGCTGCACCATGGAACCCCTGCTGAAGTGGCTGCGAAACCGGATCCAGCGCTGTACAGCAGATTCTCAGCT
GGCTGAGTGCCGGGGCCCTCCTGAAGTCGAGGGCGCCCCGCTCTTCTCACTCACTGAGGAGAGCTTCAAGGCCTGCCACC
TGACCCTGACCCTGGATGATTACCTATTCATTGCGTTTGTGGGCTTCGTGGTCTCCATTGCTTCTGTGGCCACCAACTTC
CTCCTGGGCATCACTGCCAACTGCTGCCACCGCTGGAGCAAGGCCAGTGAAGAGGAAGAGATCTTGCCAACTTTCTTGTA
CAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CATSPER2-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGCCGCTTACCAACAAGAAGAGCAGATGCAGCTTCCCCGAGCTGATGCCATTCGTTCACGTCTCATCGATACTTTCTC
TCTCATTGAGCATTTGCAAGGCTTGAGCCAAGCTGTGCCGCGGCACACTATCAGGAAGTTACTTGATCCTTCCCGCCAGA
AGAAACTTGTATTGGGAGATCAACACCAGCTAGTGCGTTTCTCTATAAAGCCTCAGCGTATAGAACAGATTTCACATGCC
CAGAGGCTGTTGAGCAGGCTTCATGTGCGCTGCAGTCAGAGGCCACCTCTTTCTTTGTGGGCCGGATGGGTCCTTGAGTG
TCCTCTCTTCAAAAACTTCATCATCTTCCTGGTCTTTTTGAATACGATCATATTGATGGTTGAAATAGAATTGCTGGAAT
CCACAAATACCAAACTATGGCCATTGAAGCTGACCTTGGAGGTGGCAGCTTGGTTTATCTTGCTTATTTTCATCCTGGAG
ATCCTTCTTAAGTGGCTATCCAACTTTTCTGTTTTCTGGAAGAGTGCCTGGAATGTCTTTGACTTTGTTGTTACCATGTT
GGTAAGGATAGAGATCCTGAGGGTTCGTTTAGTGGGATGCCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTA
ACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CACNG3-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

 

Single Cell Clones:

C2 shows membranous expression of V5, cell population appears homogenous. 

Sequence

ORF Sequence:

ATGAGGATGTGTGACAGAGGTATCCAGATGTTGATCACCACTGTAGGAGCCTTTGCCGCTTTTAGTTTAATGACCATTGC AGTGGGCACGGACTACTGGTTATATTCCAGAGGTGTGTGCAGGACTAAATCTACAAGTGATAATGAAACCAGCAGGAAGA ATGAAGAAGTAATGACCCATTCGGGGCTGTGGAGGACCTGCTGCCTAGAAGGGGCTTTCCGAGGCGTGTGCAAGAAAATC GATCACTTCCCTGAAGATGCTGACTACGAACAGGACACAGCCGAATATCTCCTGCGAGCTGTGAGGGCCTCCAGTGTCTT CCCCATCCTCAGTGTCACGCTGCTGTTCTTCGGCGGGCTCTGCGTGGCAGCCAGTGAGTTCCACCGCAGCAGACACAACG TCATTCTCAGCGCGGGCATCTTTTTTGTCTCTGCAGGGTTAAGCAACATCATTGGCATCATAGTTTATATATCAGCCAAC GCCGGAGACCCCGGGCAGCGTGACTCCAAAAAAAGTTACTCCTATGGTTGGTCCTTTTATTTCGGAGCCTTCTCTTTCAT CATCGCAGAAATTGTAGGAGTGGTTGCCGTGCACATCTATATTGAAAAACATCAGCAGTTACGAGCCAAATCCCACTCGG AGTTCCTGAAGAAATCTACTTTTGCCCGCCTCCCACCCTACAGGTATCGATTCCGGAGGCGGTCAAGTTCTCGCTCCACC GAGCCCAGATCCCGAGACCTGTCCCCCATCAGCAAAGGCTTCCACACCATCCCTTCCACTGACATCTCGATGTTCACCCT CTCCCGGGACCCCTCAAAGATCACCATGGGGACCCTCCTCAACTCCGACCGGGACCACGCTTTTCTACAGTTCCACAATT CCACACCCAAAGAGTTCAAAGAGTCACTGCATAATAATCCGGCCAACAGGCGCACCACGCCCGTCTGCCCAACTTTCTTG TACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-FXYD3-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

 

Single Cell Clones:

Clone G10-- V5 expression is heterogenous, appears to be intracellular

Sequence

ORF Sequence:

ATGCAGAAGGTGACCCTGGGCCTGCTTGTGTTCCTGGCAGGCTTTCCTGTCCTGGACGCCAATGACCTAGAAGATAAAAA CAGTCCTTTCTACTATGACTGGCACAGCCTCCAGGTTGGCGGGCTCATCTGCGCTGGGGTTCTGTGCGCCATGGGCATCA TCATCGTCATGAGTGCAAAATGCAAATGCAAGTTTGGCCAGAAGTCCGGTCACCATCCAGGGGAGACTCCACCTCTCATC ACCCCAGGCTCAGCCCAAAGCTGCCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCT CGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CACNA2D4-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGTATGACTATCAGGCCATGTGCAAACCCTCGAGTCACCACCACAGTGCAGCCCAGCCCCTGGTCAGCCCAATTTCTGCCTTCTTGACGGCGACCAGGTGGCTGCTGCAGGAGCTGGTGCTGTTCCTGCTGGAGTGGAGTGTCTGGGGCTCCTGGTACGACAGAGGGGCCGAGGCCAAAAGTGTCTTCCATCACTCCCACAAACACAAGAAGCAGGACCCGCTGCAGCCCTGCGACACGGAGTACCCCGTGTTCGTGTACCAGCCGGCCATCCGGGAGGCCAACGGGATCGTGGAGTGCGGGCCCTGCCAGAAGGTATTTGTGGTGCAGCAGATTCCCAACAGTAACCTCCTCCTCCTGGTGACAGACCCCACCTGTGACTGCAGCATCTTCCCACCAGTGCTGCAGGAGGCGACAGAAGTCAAATATAATGCCTCTGTCAAATGTGACCGGATGCGCTCCCAGAAGCTCCGCCGGCGACCAGACTCCTGCCACGCCTTCCATCCAGAGGAGAATGCCCAGGACTGCGGCGGCGCCTCGGACACCTCAGCCTCGCCGCCCCTACTCCTGCTGCCTGTGTGTGCCTGGGGGCTACTGCCCCAACTCCTGCGGTGTCCAACTTTCTTGTACAAAGTGGTTG GTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CLCN6-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGCGGGGTGCAGGGGGTCTCTGTGCTGCTGCTGCAGGTGGTGCTGCTGCTGCGGTGAGCGTGAGACCCGCACCCCCGA
GGAGCTGACCATCCTTGGAGAAACACAGGAGGAGGAGGATGAGATTCTTCCAAGGAAAGACTATGAGAGTTTGGATTATG
ATCGCTGTATCAATGACCCTTACCTGGAAGTTTTGGAGACCATGGATAATAAGAAAGGTCGAAGATATGAGGCGGTGAAG
TGGATGGTGGTGTTTGCCATTGGAGTCTGCACTGGCCTGGTGGGTCTCTTTGTGGACTTTTTTGTGCGACTCTTCACCCA
ACTCAAGTTCGGAGTGGTACAGACATCGGTGGAGGAGTGCAGCCAGAAAGGCTGCCTCGCTCTGTCTCTCCTTGAACTCC
TGGGTTTTAACCTCACCTTTGTCTTCCTGGCAAGCCTCCTTGTTCTCATTGAGCCGGTGGCAGCAGGTTCCGGGATACCC
GAGGTCAAATGCTATCTGAATGGCGTAAAGGTGCCAGGAATCGTCCGTCTCCGGACCCTGCTCTGCAAGGTCCTTGGAGT
GCTGTTCAGTGTGGCTGGAGGGCTCTTCGTGGGGAAGGAAGGCCCCATGATCCACAGTGGTTCGGTGGTGGGAGCTGGCC
TCCCTCAGTTTCAGAGCATCTCCTTACGGAAGATCCAGTTTAACTTCCCCTATTTCCGAAGCGACAGAGACAAGAGAGAC
TTTGTATCAGCAGGAGCGGCTGCTGGAGTTGCTGCAGCTTTCGGGGCGCCAATCGGGGGTACCTTGTTCAGTCTAGAGGA
GGGTTCGTCCTTCTGGAACCAAGGGCTCACGTGGAAAGTGCTCTTTTGTTCCATGTCTGCCACCTTCACCCTCAACTTCT
TCCATTCTGGGATTCAGTTTGGAAGCTGGGGTTCCTTCCAGCTCCCTGGATTGCTGAACTTTGGCGAGTTTAAGTGCTCT
GACTCTGATAAAAAATGTCATCTCTGGACAGCTATGGATTTGGGTTTCTTCGTCGTGATGGGGGTCATTGGGGGCCTCCT
GGGAGCCACATTCAACTGTCTGAACAAGAGGCTTGCAAAGTACCGTATGCGAAACGTGCACCCGAAACCTAAGCTCGTCA
GAGTCTTAGAGAGCCTCCTTGTGTCTCTGGTAACCACCGTGGTGGTGTTTGTGGCCTCGATGGTGTTAGGAGAATGCCGA
CAGATGTCCTCTTCGAGTCAAATCGGTAATGACTCATTCCAGCTCCAGGTCACAGAAGATGTGAATTCAAGTATCAAGAC
ATTTTTTTGTCCCAATGATACCTACAATGACATGGCCACACTCTTCTTCAACCCGCAGGAGTCTGCCATCCTCCAGCTCT
TCCACCAGGATGGTACTTTCAGCCCCGTCACTCTGGCCTTGTTCTTCGTTCTCTATTTCTTGCTTGCATGTTGGACTTAC
GGCATTTCTGTTCCAAGTGGCCTTTTTGTGCCTTCTCTGCTGTGTGGAGCTGCTTTTGGACGTTTAGTTGCCAATGTCCT
AAAAAGCTACATTGGATTGGGCCACATCTATTCGGGGACCTTTGCCCTGATTGGTGCAGCGGCTTTCTTGGGCGGGGTGG
TCCGCATGACCATCAGCCTCACGGTCATCCTGATCGAGTCCACCAATGAGATCACCTACGGGCTCCCCATCATGGTCACA
CTGATGGTGGCCAAATGGACAGGGGACTTTTTCAATAAGGGCATTTATGATATCCACGTGGGCCTGCGAGGCGTGCCGCT
TCTGGAATGGGAGACAGAGGTGGAAATGGACAAGCTGAGAGCCAGCGACATCATGGAGCCCAACCTGACCTACGTCTACC
CGCACACCCGCATCCAGTCTCTGGTGAGCATCCTGCGCACCACGGTCCACCATGCCTTCCCGGTGGTCACAGAGAACCGC
GGTAACGAGAAGGAGTTCATGAAGGGCAACCAGCTCATCAGCAACAACATCAAGTTCAAGAAATCCAGCATCCTCACCCG
GGCTGGCGAGCAGCGCAAACGGAGCCAGTCCATGAAGTCCTACCCATCCAGCGAGCTACGGAACATGTGTGATGAGCACA
TCGCCTCTGAGGAGCCAGCCGAGAAGGAGGACCTCCTGCAGCAGATGCTGGAAAGGAGATACACTCCCTACCCCAACCTA
TACCCTGACCAGTCCCCAAGTGAAGACTGGACCATGGAGGAGCGGTTCCGCCCTCTGACCTTCCACGGCCTGATCCTTCG
GTCGCAGCTTGTCACCCTGCTTGTCCGAGGAGTTTGTTACTCTGAAAGCCAGTCGAGCGCCAGCCAGCCGCGCCTCTCCT
ATGCCGAGATGGCCGAGGACTACCCGCGGTACCCCGACATCCACGACCTGGACCTGACGCTGCTCAACCCGCGCATGATC
GTGGATGTCACCCCATACATGAACCCTTCGCCTTTCACCGTCTCGCCCAACACCCACGTCTCCCAAGTCTTCAACCTGTT
CAGAACGATGGGCCTGCGCCACCTGCCCGTGGTGAACGCTGTGGGAGAGATCGTGGGGATCATCACACGGCACAACCTCA
CCTATGAATTTCTGCAGGCCCGGCTGAGGCAGCACTACCAGACCATCTTGCCAACTTTCTTGTACAAAGTGGTTGGTAAG
CCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CHRNA10-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGGGCTCCGGAGCCACCACCTCAGCCTGGGCCTTCTGCTTCTGTTTCTACTCCCTGCAGAGTGCCTGGGAGCTGAGGG
CCGGCTGGCTCTCAAGCTGTTCCGTGACCTCTTTGCCAACTACACAAGTGCCCTGAGACCTGTGGCAGACACAGACCAGA
CTCTGAATGTGACCCTGGAGGTGACACTGTCCCAGATCATCGACATGGATGAACGGAACCAGGTGCTGACCCTGTATCTG
TGGATACGGCAGGAGTGGACAGATGCCTACCTACGATGGGACCCCAATGCCTATGGTGGCCTGGATGCCATCCGCATCCC
CAGCAGTCTTGTGTGGCGGCCAGACATCGTACTCTATAACAAAGCCGACGCGCAGCCTCCAGGTTCCGCCAGCACCAACG
TGGTCCTGCGCCACGATGGCGCCGTGCGCTGGGACGCGCCGGCCATCACGCGCAGCTCGTGCCGCGTGGATGTAGCAGCC
TTCCCGTTCGACGCCCAGCACTGCGGCCTGACGTTCGGCTCCTGGACTCACGGCGGGCACCAACTGGATGTGCGGCCGCG
CGGCGCTGCAGCCAGCCTGGCGGACTTCGTGGAGAACGTGGAGTGGCGCGTGCTGGGCATGCCGGCGCGGCGGCGCGTGC
TCACCTACGGCTGCTGCTCCGAGCCCTACCCCGACGTCACCTTCACGCTGCTGTTGCGCCGCCGCGCCGCCGCCTACGTG
TGCAACCTGCTGCTGCCCTGCGTGCTCATCTCGCTGCTTGCGCCGCTCGCCTTCCACCTGCCTGCCGACTCAGGCGAGAA
GGTGTCGCTGGGCGTCACCGTGCTGCTGGCGCTCACCGTCTTCCAGTTGCTGCTGGCCGAGAGCATGCCACCGGCCGAGA
GCGTGCCGCTCATCGGGAAGTACTACATGGCCACTATGACCATGGTCACATTCTCAACAGCACTCACCATCCTTATCATG
AACCTGCATTACTGTGGTCCCAGTGTCCGCCCAGTGCCAGCCTGGGCTAGGGCCCTCCTGCTGGGACACCTGGCACGGGG
CCTGTGCGTGCGGGAAAGAGGGGAGCCCTGTGGGCAGTCCAGGCCACCTGAGTTATCTCCTAGCCCCCAGTCGCCTGAAG
GAGGGGCTGGCCCCCCAGCGGGCCCTTGCCACGAGCCACGATGTCTGTGCCGCCAGGAAGCCCTACTGCACCACGTAGCC
ACCATTGCCAATACCTTCCGCAGCCACCGAGCTGCCCAGCGCTGCCATGAGGACTGGAAGCGCCTGGCCCGTGTGATGGA
CCGCTTCTTCCTGGCCATCTTCTTCTCCATGGCCCTGGTCATGAGCCTCCTGGTGCTGGTGCAGGCCCTGTCAGGCCTCA
TGGGCCCAGCTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CACNG5-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGAGTGCCTGCGGGAGGAAGGCCCTGACCCTGCTGAGCAGTGTCTTTGCTGTCTGTGGCTTGGGCCTCCTGGGTATCGC
GGTCAGCACCGACTACTGGCTGTACCTGGAGGAGGGTGTGATTGTGCCCCAGAACCAGAGCACCGAGATCAAGATGTCCC
TGCACTCAGGCCTCTGGCGGGTCTGCTTCCTTGCAGGTGAGGAGCGGGGGCGTTGCTTCACCATAGAATATGTGATGCCC
ATGAACACCCAGCTGACATCCGAGTCCACGGTCAATGTTCTAAAGATGATCCGCTCAGCCACACCATTCCCTCTGGTCAG
CCTCTTCTTCATGTTCATTGGGTTTATCCTGAACAACATCGGACACATCCGTCCCCACCGGACGATACTGGCCTTTGTCT
CTGGCATCTTCTTTATCCTCTCAGGCCTCTCTCTCGTGGTGGGCCTGGTGCTCTACATCTCCAGCATCAACGATGAGATG
CTCAACAGGACCAAGGATGCAGAGACCTACTTCAACTACAAGTATGGGTGGTCGTTTGCCTTCGCCGCCATCTCCTTCCT
TTTAACGGAGAGTGCCGGGGTGATGTCTGTGTACCTGTTTATGAAGCGGTACACCGCGGAGGACATGTACAGGCCCCACC
CTGGCTTCTACCGCCCTCGGCTGAGCAACTGCTCCGATTACTCAGGCCAGTTCCTACACCCAGACGCCTGGGTCAGGGGC
CGCAGCCCCTCCGACATCTCCAGCGAGGCCTCCCTGCAGATGAACAGCAACTACCCCGCCTTGCTCAAGTGCCCCGACTA
TGATCAGATGTCCTCTTCACCCTGCTTGCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCG
GTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-GABRA5-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGAGAATGGAATGTTCTCTGGTTTTATCATGATCAAAAACCTCCTTCTCTTTTGTATTTCCATGAACTTATCCAGTCA
CTTTGGCTTTTCACAGATGCCAACCAGTTCAGTGAAAGATGAGACCAATGACAACATCACGATATTTACCAGGATCTTGG
ATGGGCTCTTGGATGGCTACGACAACAGACTTCGGCCCGGGCTGGGAGAGCGCATCACTCAGGTGAGGACCGACATCTAC
GTCACCAGCTTCGGCCCGGTGTCCGACACGGAAATGGAGTACACCATAGACGTGTTTTTCCGACAAAGCTGGAAAGATGA
AAGGCTTCGGTTTAAGGGGCCCATGCAGCGCCTCCCTCTCAACAACCTCCTTGCCAGCAAGATCTGGACCCCAGACACGT
TCTTCCACAACGGGAAGAAGTCCATCGCTCACAACATGACCACGCCCAACAAGCTGCTGCGGCTGGAGGACGACGGCACC
CTGCTCTACACCATGCGCTTGACCATCTCTGCAGAGTGCCCCATGCAGCTTGAGGACTTCCCGATGGATGCGCACGCTTG
CCCTCTGAAATTTGGCAGCTATGCGTACCCTAATTCTGAAGTCGTCTACGTCTGGACCAACGGCTCCACCAAGTCGGTGG
TGGTGGCGGAAGATGGCTCCAGACTGAACCAGTACCACCTGATGGGGCAGACGGTGGGCACTGAGAACATCAGCACCAGC
ACAGGCGAATACACAATCATGACAGCTCACTTCCACCTGAAAAGGAAGATTGGCTACTTTGTCATCCAGACCTACCTTCC
CTGCATAATGACCGTGATCTTATCACAGGTGTCCTTTTGGCTGAACCGGGAATCAGTCCCAGCCAGGACAGTTTTTGGGG
TCACCACGGTGCTGACCATGACGACCCTCAGCATCAGCGCCAGGAACTCTCTGCCCAAAGTGGCCTACGCCACCGCCATG
GACTGGTTCATAGCCGTGTGCTATGCCTTCGTCTTCTCGGCGCTGATAGAGTTTGCCACGGTCAATTACTTTACCAAGAG
AGGCTGGGCCTGGGATGGCAAAAAAGCCTTGGAAGCAGCCAAGATCAAGAAAAAGCGTGAAGTCATACTAAATAAGTCAA
CAAACGCTTTTACAACTGGGAAGATGTCTCACCCCCCAAACATTCCGAAGGAACAGACCCCAGCAGGGACGTCGAATACA
ACCTCAGTCTCAGTAAAACCCTCTGAAGAGAAGACTTCTGAAAGCAAAAAGACTTACAACAGTATCAGCAAAATTGACAA
AATGTCCCGAATCGTATTCCCAGTCTTGTTCGGCACTTTCAACTTAGTTTACTGGGCAACGTATTTGAATAGGGAGCCGG
TGATAAAAGGAGCCGCCTCTTCAAAATACCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTC
GGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CACNB1-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

 

Single Cell Clones:

 

H3-- Low Membraneous V5 expression

Sequence

ORF Sequence:

ATGTCCCGGGGCCCTTACCCACCCTCCCAGGAGATCCCCATGGAGGTCTTCGACCCCAGCCCGCAGGGCAAATACAGCAA GAGGAAAGGGCGATTCAAACGGTCAGATGGGAGCACGTCCTCGGATACCACATCCAACAGCTTTGTCCGCCAGGGCTCAG CGGAGTCCTACACCAGCCGTCCATCAGACTCTGATGTATCTCTGGAGGAGGACCGGGAAGCCTTAAGGAAGGAAGCAGAG CGCCAGGCATTAGCGCAGCTCGAGAAGGCCAAGACCAAGCCAGTGGCATTTGCTGTGCGGACAAATGTTGGCTACAATCC GTCTCCAGGGGATGAGGTGCCTGTGCAGGGAGTGGCCATCACCTTCGAGCCCAAAGACTTCCTGCACATCAAGGAGAAAT ACAATAATGACTGGTGGATCGGGCGGCTGGTGAAGGAGGGCTGTGAGGTTGGCTTCATTCCCAGCCCCGTCAAACTGGAC AGCCTTCGCCTGCTGCAGGAACAGAAGCTGCGCCAGAACCGCCTCGGCTCCAGCAAATCAGGCGATAACTCCAGTTCCAG TCTGGGAGATGTGGTGACTGGCACCCGCCGCCCCACACCCCCTGCCAGTGCCAAACAGAAGCAGAAGTCGACAGAGCATG TGCCCCCCTATGACGTGGTGCCTTCCATGAGGCCCATCATCCTGGTGGGACCGTCGCTCAAGGGCTACGAGGTTACAGAC ATGATGCAGAAAGCTTTATTTGACTTCTTGAAGCATCGGTTTGATGGCAGGACCTCCATCACTCGTGTGACGGCAGATAT TTCCCTGGCTAAGCGCTCAGTTCTCAACAACCCCAGCAAACACATCATCATTGAGCGCTCCAACACACGCTCCAGCCTGG CTGAGGTGCAGAGTGAAATCGAGCGAATCTTCGAGCTGGCCCGGACCCTTCAGTTGGTCGCTCTGGATGCTGACACCATC AATCACCCAGCCCAGCTGTCCAAGACCTCGCTGGCCCCCATCATTGTTTACATCAAGATCACCTCTCCCAAGGTACTTCA AAGGCTCATCAAGTCCCGAGGAAAGTCTCAGTCCAAACACCTCAATGTCCAAATAGCGGCCTCGGAAAAGCTGGCACAGT GCCACCCTGAAATGTTTGACATCATCCTGGATGAGAACCAATTGGAGGATGCCTGCGAGCATCTGGCGGAGTACTTGGAA GCCTATTGGAAGGCCACACACCCGCCCAGCAGCACGCCACCCAATCCGCTGCTGAACCGCACCATGGCTACCGCAGCCCT GGCTGCCAGCCCTGCCCCTGTCTCCAACCTCCAGGGACCCTACCTTGCTTCCGGGGACCAGCCACTGGAACGGGCCACCG GGGAGCACGCCAGCATGCACGAGTACCCAGGGGAGCTGGGCCAGCCCCCAGGCCTTTACCCCAGCAGCCACCCACCAGGC CGGGCAGGCACGCTACGGGCACTGTCCCGCCAAGACACTTTTGATGCCGACACCCCCGGCAGCCGAAACTCTGCCTACAC GGAGCTGGGAGACTCATGTGTGGACATGGAGACTGACCCCTCAGAGGGGCCAGGGCTTGGAGACCCTGCAGGGGGCGGCA CGCCCCCAGCCCGACAGGGATCCTGGGAGGACGAGGAAGAAGACTATGAGGAAGAGCTGACCGACAACCGGAACCGGGGC CGGAATAAGGCCCGCTACTGCGCTGAGGGTGGGGGTCCAGTTTTGGGGCGCAACAAGAATGAGCTGGAGGGCTGGGGACG AGGCGTCTACATTCGCTGCCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATT CTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CLCNKA-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGAGGAGTTGGTGGGGCTGCGTGAGGGCTTCTCAGGGGACCCTGTGACTCTGCAGGAGCTGTGGGGCCCCTGTCCCCA
CATCCGCCGAGCCATCCAAGGTGGCCTGGAGTGGCTAAAGCAGAAGGTGTTCCGCCTGGGAGAAGACTGGTACTTCCTGA
TGACCCTCGGGGTGCTCATGGCCCTGGTCAGCTATGCCATGAACTTTGCCATCGGGTGTGTGGTCCGAGCACACCAGTGG
CTGTACAGGGAGATTGGGGACAGCCACCTGCTCCGGTATCTTTCCTGGACTGTGTACCCTGTGGCCCTCGTCTCTTTCTC
CTCAGGCTTCTCCCAGAGCATCACGCCCTCCTCTGGAGGTTCTGGAATCCCGGAGCTGAAGACCATGTTGGCGGGTGTGA
TCTTGGAGGACTACCTGGATATCAAGAACTTTGGGGCCAAGGTGGTGGGCCTCTCCTGCACCCTGGCCACCGGCAGCACC
CTGTTCCTGGGCAAAGTGGGCCCTTTCGTGCACCTGTCTGTAATGATCGCTGCCTACCTGGGCCGTGTGCGCACCACGAC
CATCGGGGAGCCTGAGAACAAGAGCAAGCAAAACGAAATGCTGGTGGCAGCGGCGGCAGTGGGCGTGGCCACAGTCTTTG
CAGCTCCCTTCAGCGGCGTCCTGTTCAGCATCGAGGTCATGTCTTCCCACTTCTCTGTCCGGGATTACTGGAGGGGCTTC
TTTGCGGCCACCTGCGGGGCCTTCATATTCCGGCTCCTGGCAGTCTTCAACAGCGAGCAGGAGACCATCACCTCCCTCTA
CAAGACCAGTTTCCGGGTGGACGTTCCCTTCGACCTGCCTGAGATCTTCTTTTTTGTGGCGCTGGGTGGCATCTGCGGCG
TCCTGAGCTGTGCTTACCTCTTCTGTCAGCGAACCTTCCTCAGCTTCATCAAGACCAATCGGTTCAGCTCCAAACTGCTG
GCTACTAGCAAGCCTGTGTACTCCGCTCTGGCCACCTTGCTTCTCGCCTCCATCACCTACCCGCCTGGTGTGGGCCACTT
CCTAGCTTCTCGGCTGTCCATGAAGCAGCATCTGGACTCGCTGTTCGACAACCACTCCTGGGCGCTGATGACCCAGAACT
CCAGCCCACCCTGGCCCGAGGAGCTCGACCCCCAGCACCTTTGGTGGGAATGGTACCACCCGCGGTTCACCATCTTTGGG
ACCCTTGCCTTCTTCCTGGTTATGAAGTTCTGGATGCTGATTCTGGCCACCACCATCCCCATGCCTGCCGGGTACTTCAT
GCCCATCTTTATCCTTGGAGCTGCCATCGGGCGCCTCTTGGGAGAGGCTCTTGCCGTCGCCTTCCCTGAGGGCATTGTGA
CTGGAGGGGTTACCAATCCCATCATGCCCGGGGGGTATGCTCTGGCAGGGGCTGCAGCCTTCTCAGGGGCTGTGACCCAC
ACCATCTCCACGGCGCTGCTGGCCTTTGAGCTGACCGGCCAGATAGTGCATGCACTGCCCGTGCTGATGGCGGTGCTGGC
AGCCAACGCCATTGCACAGAGCTGCCAGCCCTCCTTCTATGATGGCACCATCATTGTCAAGAAGCTGCCATACCTGCCAC
GGATTCTGGGCCGCAACATCGGCTCCCACCATGTGAGGGTGGAGCACTTCATGAACCACAGCATCACCACACTGGCCAAG
GACACGCCGCTGGAGGAGGTGGTCAAGGTTGTGACCTCCACAGACGTGACCGAGTATCCCCTGGTGGAGAGCACAGAGTC
CCAGATCCTGGTAGGCATCGTGCAGAGGGCCCAGCTGGTGCAGGCCCTCCAGGCTGAGCCTCCTTCCAGGGCTCCAGGAC
ACCAGTGTCTCCAGGACATCTTGGCCAGGGGCTGCCCCACGGAACCAGTGACCCTGACGCTATTCTCAGAGACCACCTTG
CACCAGGCACAAAACCTCTTTAAGCTGTTGAACCTTCAGTCCCTCTTCGTGACATCGCGGGGCAGAGCTGTGGGCTGCGT
GTCCTGGGTGGAGATGAAGAAAGCAATTTCCAACCTGACAAATCCGCCAGCTCCAAAGACAGCTTTCTTGTACAAAGTGG
TTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CHRNA2-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGGCCCCTCCTGTCCTGTGTTCCTGTCCTTCACAAAGCTCAGCCTGTGGTGGCTCCTTCTGACCCCAGCAGGTGGAGA
GGAAGCTAAGCGCCCACCTCCCAGGGCTCCTGGAGACCCACTCTCCTCTCCCAGTCCCACGGCATTGCCGCAGGGAGGCT
CGCATACCGAGACTGAGGACCGGCTCTTCAAACACCTCTTCCGGGGCTACAACCGCTGGGCGCGCCCGGTGCCCAACACT
TCAGACGTGGTGATTGTGCGCTTTGGACTGTCCATCGCTCAGCTCATCGATGTGGATGAGAAGAACCAAATGATGACCAC
CAACGTCTGGCTAAAACAGGAGTGGAGCGACTACAAACTGCGCTGGAACCCCACTGATTTTGGCAACATCACATCTCTCA
GGGTCCCTTCTGAGATGATCTGGATCCCCGACATTGTTCTCTACAACAATGCAGATGGGGAGTTTGCAGTGACCCACATG
ACCAAGGCCCACCTCTTCTCCACGGGCACTGTGCACTGGGTGCCCCCGGCCATCTACAAGAGCTCCTGCAGCATCGACGT
CACCTTCTTCCCCTTCGACCAGCAGAACTGCAAGATGAAGTTTGGCTCCTGGACTTATGACAAGGCCAAGATCGACCTGG
AGCAGATGGAGCAGACTGTGGACCTGAAGGACTACTGGGAGAGCGGCGAGTGGGCCATCGTCAATGCCACGGGCACCTAC
AACAGCAAGAAGTACGACTGCTGCGCCGAGATCTACCCCGACGTCACCTACGCCTTCGTCATCCGGCGGCTGCCGCTCTT
CTACACCATCAACCTCATCATCCCCTGCCTGCTCATCTCCTGCCTCACTGTGCTGGTCTTCTACCTGCCCTCCGACTGCG
GCGAGAAGATCACGCTGTGCATTTCGGTGCTGCTGTCACTCACCGTCTTCCTGCTGCTCATCACTGAGATCATCCCGTCC
ACCTCGCTGGTCATCCCGCTCATCGGCGAGTACCTGCTGTTCACCATGATCTTCGTCACCCTGTCCATCGTCATCACCGT
CTTCGTGCTCAATGTGCACCACCGCTCCCCCAGCACCCACACCATGCCCCACTGGGTGCGGGGGGCCCTTCTGGGCTGTG
TGCCCCGGTGGCTTCTGATGAACCGGCCCCCACCACCCGTGGAGCTCTGCCACCCCCTACGCCTGAAGCTCAGCCCCTCT
TATCACTGGCTGGAGAGCAACGTGGATGCCGAGGAGAGGGAGGTGGTGGTGGAGGAGGAGGACAGATGGGCATGTGCAGG
TCATGTGGCCCCCTCTGTGGGCACCCTCTGCAGCCACGGCCACCTGCACTCTGGGGCCTCAGGTCCCAAGGCTGAGGCTC
TGCTGCAGGAGGGTGAGCTGCTGCTATCACCCCACATGCAGAAGGCACTGGAAGGTGTGCACTACATTGCCGACCACCTG
CGGTCTGAGGATGCTGACTCTTCGGTGAAGGAGGACTGGAAGTATGTTGCCATGGTCATCGACAGGATCTTCCTCTGGCT
GTTTATCATCGTCTGCTTCCTGGGGACCATCGGCCTCTTTCTGCCTCCGTTCCTAGCTGGAATGATCACAGCTTTCTTGT
ACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CACNG7-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGAGTCACTGCAGCAGCCGCGCCCTGACCCTGCTGAGCAGCGTGTTTGGTGCGTGTGGCCTGCTCCTGGTAGGCATCGC
GGTCAGCACTGACTACTGGCTGTACATGGAAGAAGGCACAGTGCTACCGCAGAACCAGACCACCGAGGTCAAGATGGCCC
TGCACGCCGGCCTCTGGCGAGTCTGCTTCTTTGCAGGTCGGGAGAAAGGTCGCTGTGTGGCCTCAGAATATTTTCTTGAA
CCGGAGATCAATTTGGTGACGGAAAACACGGAGAATATTCTGAAGACAGTGCGCACGGCCACCCCCTTCCCCATGGTCAG
CCTCTTCCTCGTGTTCACGGCCTTCGTCATCAGCAACATCGGCCACATCCGCCCGCAGAGGACCATTCTGGCTTTTGTCT
CTGGCATCTTCTTCATACTATCGGGCCTCTCCTTGGTGGTGGGCTTGGTTCTTTACATCTCCAGCATCAACGACGAGGTC
ATGAACAGGCCCAGCAGCTCTGAGCAGTATTTTCATTATCGCTACGGGTGGTCTTTTGCCTTCGCCGCTTCCTCCTTCCT
ACTCAAAGAGGGGGCCGGCGTGATGTCCGTGTACCTGTTCACCAAGCGCTACGCGGAGGAGGAGATGTACCGTCCACACC
CGGCCTTCTACCGCCCGCGTCTCAGCGACTGCTCCGACTACTCGGGCCAGTTCCTGCAGCCCGAGGCGTGGCGCCGCGGC
CGGAGCCCCTCCGACATCTCCAGCGACGTGTCCATCCAAATGACGCAGAACTACCCTCCCGCCATCAAGTACCCGGACCA
CCTGCACATCTCCACCTCGCCCTGCTTGCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCG
GTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-GABRG1-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGGTCCTTTGAAAGCTTTTCTCTTCTCCCCTTTTCTTCTGCGGAGTCAAAGTAGAGGGGTGAGGTTGGTCTTCTTGTT
ACTGACCCTGCATTTGGGAAACTGTGTTGATAAGGCAGATGATGAAGATGATGAGGATTTAACGGTGAACAAAACCTGGG
TCTTGGCCCCAAAAATTCATGAAGGAGATATCACACAAATTCTGAATTCATTGCTTCAAGGCTATGACAATAAACTTCGT
CCAGATATAGGAGTGAGGCCCACAGTAATTGAAACTGATGTTTATGTAAACAGCATTGGACCAGTTGATCCAATTAATAT
GGAATATACAATAGATATAATTTTTGCCCAAACCTGGTTTGACAGTCGTTTAAAATTCAATAGTACCATGAAAGTGCTTA
TGCTTAACAGTAATATGGTTGGAAAAATTTGGATTCCTGACACTTTCTTCAGAAACTCAAGAAAATCTGATGCTCACTGG
ATAACAACTCCTAATCGTCTGCTTCGAATTTGGAATGATGGACGAGTTCTGTATACTCTAAGATTGACAATTAATGCAGA
ATGTTATCTTCAGCTTCATAACTTTCCCATGGATGAACATTCCTGTCCACTGGAATTTTCAAGCTATGGATACCCTAAAA
ATGAAATTGAGTATAAGTGGAAAAAGCCCTCCGTAGAAGTGGCTGATCCTAAATACTGGAGATTATATCAGTTTGCATTT
GTAGGGTTACGGAACTCAACTGAAATCACTCACACGATCTCTGGGGATTATGTTATCATGACAATTTTTTTTGACCTGAG
CAGAAGAATGGGATATTTCACTATTCAGACCTACATTCCATGCATTCTGACAGTTGTTCTTTCTTGGGTGTCTTTTTGGA
TCAATAAAGATGCAGTGCCTGCAAGAACATCGTTGGGTATCACTACAGTTCTGACTATGACAACCCTGAGTACAATTGCC
AGGAAGTCTTTACCTAAGGTTTCTTATGTGACTGCGATGGATCTCTTTGTTTCTGTTTGTTTCATTTTTGTTTTTGCAGC
CTTGATGGAATATGGAACCTTGCATTATTTTACCAGCAACCAAAAAGGAAAGACTGCTACTAAAGACAGAAAGCTAAAAA
ATAAAGCCTCGATGACTCCTGGTCTCCATCCTGGATCCACTCTGATTCCAATGAATAATATTTCTGTGCCGCAAGAAGAT
GATTATGAGTATCAGTGTTTGGAGGGCAAAGATTGTGCCAGCTTCTTCTGTTGCTTTGAAGACTGCAGAACAGGATCTTG
GAGGGAAGGAAGGATACACATACGCATTGCCAAAATTGACTCTTATTCTAGAATATTTTTCCCAACCGCTTTTGCCCTGT
TCAACTTGGTTTATTGGGTTGGCTATCTTTACTTAACAGCTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCT
CTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CACNB2-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGTCCAAAGGGACATGTCCAAGTCGCCTCCCACAGCGGCGGCGGCGGTGGCGCAGGAGATCCAGATGGAACTGCTAGA GAACGTGGCTCCCGCGGGGGCGCTCGGAGCCGCCGCACAGTCATATGGAAAAGGAGCCAGAAGGAAAAACAGATTTAAAG GATCTGATGGAAGCACGTCATCTGATACTACCTCAAATAGTTTTGTTCGCCAGGGTTCGGCAGACTCCTACACTAGCCGT CCATCCGATTCCGATGTATCTCTGGAGGAGGACCGGGAGGCAGTGCGCAGAGAAGCGGAGCGGCAGGCCCAGGCACAGTT GGAAAAAGCAAAGACAAAGCCCGTTGCATTTGCGGTTCGGACAAATGTCAGCTACAGTGCGGCCCATGAAGATGATGTTC CAGTGCCTGGCATGGCCATCTCATTCGAAGCAAAAGATTTTCTGCATGTTAAGGAAAAATTTAACAATGACTGGTGGATA GGGCGATTGGTAAAAGAAGGCTGTGAAATCGGATTCATTCCAAGCCCAGTCAAACTAGAAAACATGAGGCTGCAGCATGA ACAGAGAGCCAAGCAAGGGAAATTCTACTCCAGTAAATCAGGAGGAAATTCATCATCCAGTTTGGGTGACATAGTACCTA GTTCCAGAAAATCAACACCTCCATCATCTGCTATAGACATAGATGCTACTGGCTTAGATGCAGAAGAAAATGATATTCCA GCAAACCACCGCTCCCCTAAACCCAGTGCAAACAGTGTAACGTCACCCCACTCCAAAGAGAAAAGAATGCCCTTCTTTAA GAAGACAGAGCACACTCCTCCGTATGATGTGGTACCTTCCATGCGACCAGTGGTCCTAGTGGGCCCTTCTCTGAAGGGCT ACGAGGTCACAGATATGATGCAAAAAGCGCTGTTTGATTTTTTAAAACACAGATTTGAAGGGCGGATATCCATCACAAGG GTCACCGCTGACATCTCGCTTGCCAAACGCTCGGTATTAAACAATCCCAGTAAGCACGCAATAATAGAAAGATCCAACAC AAGGTCAAGCTTAGCGGAAGTTCAGAGTGAAATCGAAAGGATTTTTGAACTTGCAAGAACATTGCAGTTGGTGGTCCTTG ACGCGGATACAATTAATCATCCAGCTCAACTCAGTAAAACCTCCTTGGCCCCTATTATAGTATATGTAAAGATTTCTTCT CCTAAGGTTTTACAAAGGTTAATAAAATCTCGAGGGAAATCTCAAGCTAAACACCTCAACGTCCAGATGGTAGCAGCTGA TAAACTGGCTCAGTGTCCTCCAGAGCTGTTCGATGTGATCTTGGATGAGAACCAGCTTGAGGATGCCTGTGAGCACCTTG CCGACTATCTGGAGGCCTACTGGAAGGCCACCCATCCTCCCAGCAGTAGCCTCCCCAACCCTCTCCTTAGCCGTACATTA GCCACTTCAAGTCTGCCTCTTAGCCCCACCCTAGCCTCTAATTCACAGGGTTCTCAAGGTGATCAGAGGACTGATCGCTC CGCTCCTATCCGTTCTGCTTCCCAAGCTGAAGAAGAACCTAGTGTGGAACCAGTCAAGAAATCCCAGCACCGCTCTTCCT CCTCAGCCCCACACCACAACCATCGCAGTGGGACAAGTCGCGGCCTCTCCAGGCAAGAGACATTTGACTCGGAAACCCAG GAGAGTCGAGACTCTGCCTACGTAGAGCCAAAGGAAGATTATTCCCATGACCACGTGGACCACTATGCCTCACACCGTGA CCACAACCACAGAGACGAGACCCACGGGAGCAGTGACCACAGACACAGGGAGTCCCGGCACCGTTCCCGGGACGTGGATC GAGAGCAGGACCACAACGAGTGCAACAAGCAGCGCAGCCGTCATAAATCCAAGGATCGCTACTGTGAAAAGGATGGAGAA GTGATATCAAAAAAACGGAATGAGGCTGGGGAGTGGAACAGGGATGTTTACATCCGCCAAACAGCTTTCTTGTACAAAGT GGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CLIC2-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGTCAGGCCTGCGGCCCGGCACTCAAGTGGACCCTGAGATTGAGCTTTTTGTAAAGGCTGGAAGTGATGGAGAGAGTAT
TGGAAACTGTCCCTTTTGCCAACGCCTTTTCATGATCCTCTGGCTTAAAGGAGTTAAATTTAATGTGACAACTGTTGACA
TGACCAGAAAGCCTGAAGAACTAAAGGACTTAGCCCCAGGTACCAATCCTCCGTTCCTGGTGTATAACAAGGAGTTGAAA
ACAGACTTCATTAAAATTGAGGAGTTTTTAGAACAAACCCTGGCTCCTCCAAGGTACCCTCACCTGAGTCCCAAGTACAA
GGAGTCTTTTGATGTGGGCTGTAACCTCTTTGCCAAGTTTTCTGCATACATTAAGAATACACAAAAGGAGGCAAATAAGA
ATTTTGAAAAATCTCTGCTCAAAGAATTCAAGCGTCTGGATGACTACTTAAACACCCCACTTCTGGATGAAATTGATCCA
GACAGTGCTGAGGAACCCCCAGTTTCCAGAAGACTATTCTTGGATGGGGACCAGCTAACACTGGCTGATTGTAGCTTGTT
ACCCAAGCTGAACATTATTAAAGTTGCTGCCAAGAAATATCGTGACTTTGACATTCCAGCAGAATTCTCAGGAGTCTGGC
GTTATCTCCACAATGCCTATGCCCGTGAAGAATTTACCCACACGTGTCCTGAAGACAAAGAAATTGAAAATACTTACGCA
AATGTGGCTAAACAGAAGAGTTACCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCT
CGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CHRNB1-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGACCCCAGGGGCTCTGCTGATGCTGCTGGGGGCGCTGGGGGCGCCGCTCGCCCCAGGCGTCCGCGGCTCGGAGGCGGA GGGTCGACTCCGGGAGAAACTTTTCTCTGGCTATGATAGCTCCGTGCGGCCAGCGCGGGAGGTGGGAGACCGTGTCAGGG TCAGCGTTGGTCTCATCCTGGCGCAACTCATCAGCCTGAACGAGAAGGATGAAGAGATGAGCACAAAGGTGTACTTAGAC CTGGAGTGGACTGACTACAGGCTGAGCTGGGACCCTGCGGAGCACGACGGCATCGATTCGCTCCGCATCACGGCGGAATC CGTGTGGCTCCCTGACGTGGTGCTACTGAACAACAATGATGGGAATTTTGACGTGGCTCTGGACATTAGCGTCGTGGTGT CCTCCGACGGCTCCGTGCGTTGGCAACCCCCGGGCATCTATCGCAGCAGCTGCAGCATCCAGGTCACCTACTTCCCCTTC GACTGGCAGAATTGCACTATGGTGTTCAGCTCCTACAGCTACGACAGCTCGGAGGTCAGCCTGCAGACAGGCCTGGGTCC TGACGGGCAAGGGCATCAGGAAATCCACATTCATGAAGGGACTTTCATTGAGAATGGCCAGTGGGAGATTATCCACAAGC CCTCTCGGCTAATCCAGCCTCCAGGCGATCCTAGGGGAGGGAGGGAAGGACAGCGCCAGGAAGTCATCTTCTACCTCATC ATCCGCCGCAAGCCTCTCTTCTACCTGGTCAACGTCATTGCCCCATGCATCCTCATCACTCTTCTGGCCATCTTCGTCTT CTACCTGCCACCAGATGCAGGAGAGAAGATGGGGCTCTCAATCTTTGCCCTGCTGACCCTTACTGTGTTCCTGCTGCTGC TGGCTGACAAAGTACCTGAGACCTCACTATCAGTACCCATTATTATCAAGTACCTCATGTTTACCATGGTCCTCGTCACC TTCTCAGTCATCCTTAGTGTCGTGGTTCTCAACCTGCACCACCGCTCACCCCACACCCACCAAATGCCCCTTTGGGTCCG TCAGATCTTCATTCACAAACTTCCGCTGTACCTGCGTCTAAAAAGGCCCAAACCCGAGAGAGACCTGATGCCGGAGCCCC CTCACTGTTCTTCTCCAGGAAGTGGCTGGGGTCGGGGAACAGATGAATATTTCATCCGGAAGCCGCCAAGTGATTTTCTC TTCCCCAAACCCAATAGGTTCCAGCCTGAACTGTCTGCCCCTGATCTGCGGCGATTTATCGATGGTCCAAACCGGGCTGT GGCCCTGCTTCCGGAGCTACGGGAGGTCGTCTCCTCTATCAGCTACATCGCTCGACAGCTGCAGGAACAGGAGGACCACG ATGCGCTGAAGGAGGACTGGCAGTTTGTGGCCATGGTAGTGGACCGCCTCTTCCTGTGGACTTTCATCATCTTCACCAGC GTTGGGACCCTAGTCATCTTCCTGGACGCCACGTACCACTTGCCCCCTCCAGACCCCTTTCCTTGCCCAACTTTCTTGTA CAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CACNG8-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

 

Single Cell Clones: 
There are 5 single cell clonal lines. D1, D2, D7, D8, E1. V5 expression in cytosol and membrane. V5 Expression is higher in the membrane.

Sequence

ORF Sequence:

ATGACCATCGCCATCAGCACTGACTACTGGCTCTACACGCGCGCCCTCATCTGCAACACCACCAACCTCACGGCCGGCGG CGACGACGGGACCCCCCACCGCGGGGGCGGCGGCGCCTCGGAGAAGAAGGACCCCGGCGGCCTCACGCACTCGGGCCTCT GGAGGATCTGCTGCCTGGAAGGGTTGAAAAGAGGCGTCTGCGTGAAGATCAATCATTTCCCGGAGGACACGGACTACGAC CACGACAGCGCGGAGTATCTACTCCGAGTTGTCCGGGCCTCCAGCATCTTCCCCATCCTTAGCGCCATCCTGCTGCTGCT CGGGGGTGTGTGCGTGGCGGCCTCCCGCGTCTACAAGTCCAAGAGGAACATCATTCTGGGCGCAGGGATCCTGTTCGTGG CAGCAGGCCTGAGCAACATCATCGGCGTGATCGTGTACATCTCCGCCAACGCGGGCGAGCCGGGCCCGAAGCGGGACGAG GAGAAGAAAAACCACTACTCGTACGGCTGGTCCTTCTACTTCGGCGGGCTGTCGTTCATCCTGGCCGAGGTGATAGGCGT GCTGGCCGTCAACATCTACATCGAGCGCAGCCGCGAGGCGCACTGCCAGTCTCGCTCGGACCTGCTCAAGGCCGGCGGGG GCGCGGGCGGCAGTGGCGGGAGCGGCCCCTCGGCCATCCTCCGTCTGCCCAGTTACCGCTTCCGCTACCGCCGCCGCTCC CGCTCTAGCTCCCGCTCCAGCGAGCCGTCGCCGTCGCGGGACGCGTCTCCCGGCGGCCCCGGGGGCCCGGGCTTTGCCTC CACGGACATCTCCATGTACACGCTCAGCCGCGACCCCTCCAAGGGCAGCGTGGCCGCGGGGCTGGCGGGGGCCGGCGGCG GCGgcggcggcgccgtgggggcgttcGGCGGCGCGGCCGGGGGCGCCGGGGGCGGCGGCGGAGGCGGCGGCGGGGCGGGT GCCGAGCGGGACCGCGGGGGGGCGTCCGGCTTCCTCACGCTGCACAACGCCTTCCCCAAGGAGGCGGGCGGCGGCGTCAC GGTCACGGTCACCGGGCCGcccGCCCCGCCCGCGCCCGCGCCACCCGCGCCCTCTGCGCCCGCCCCCGGGACCCTGGCCA AGGAGGCCGCCGCCTCCAACACCAACACGCTCAACAGGAAAACCACGCCTGTGTCAGGCCTCATGGGCCCAGCTTTCTTG TACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-GABRP-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGAACTACAGCCTCCACTTGGCCTTCGTGTGTCTGAGTCTCTTCACTGAGAGGATGTGCATCCAGGGGAGTCAGTTCAA
CGTCGAGGTCGGCAGAAGTGACAAGCTTTCCCTGCCTGGCTTTGAGAACCTCACAGCAGGATATAACAAATTTCTCAGGC
CCAATTTTGGTGGAGAACCCGTACAGATAGCGCTGACTCTGGACATTGCAAGTATCTCTAGCATTTCAGAGAGTAACATG
GACTACACAGCCACCATATACCTCCGACAGCGCTGGATGGACCAGCGGCTGGTGTTTGAAGGCAACAAGAGCTTCACTCT
GGATGCCCGCCTCGTGGAGTTCCTCTGGGTGCCAGATACTTACATTGTGGAGTCCAAGAAGTCCTTCCTCCATGAAGTCA
CTGTGGGAAACAGGCTCATCCGCCTCTTCTCCAATGGCACGGTCCTGTATGCCCTCAGAATCACGACAACTGTTGCATGT
AACATGGATCTGTCTAAATACCCCATGGACACACAGACATGCAAGTTGCAGCTGGAAAGCTGGGGCTATGATGGAAATGA
TGTGGAGTTCACCTGGCTGAGAGGGAACGACTCTGTGCGTGGACTGGAACACCTGCGGCTTGCTCAGTACACCATAGAGC
GGTATTTCACCTTAGTCACCAGATCGCAGCAGGAGACAGGAAATTACACTAGATTGGTCTTACAGTTTGAGCTTCGGAGG
AATGTTCTGTATTTCATTTTGGAAACCTACGTTCCTTCCACTTTCCTGGTGGTGTTGTCCTGGGTTTCATTTTGGATCTC
TCTCGATTCAGTCCCTGCAAGAACCTGCATTGGAGTGACGACCGTGTTATCAATGACCACACTGATGATCGGGTCCCGCA
CTTCTCTTCCCAACACCAACTGCTTCATCAAGGCCATCGATGTGTACCTGGGGATCTGCTTTAGCTTTGTGTTTGGGGCC
TTGCTAGAATATGCAGTTGCTCACTACAGTTCCTTACAGCAGATGGCAGCCAAAGATAGGGGGACAACAAAGGAAGTAGA
AGAAGTCAGTATTACTAATATCATCAACAGCTCCATCTCCAGCTTTAAACGGAAGATCAGCTTTGCCAGCATTGAAATTT
CCAGCGACAACGTTGACTACAGTGACTTGACAATGAAAACCAGCGACAAGTTCAAGTTTGTCTTCCGAGAAAAGATGGGC
AGGATTGTTGATTATTTCACAATTCAAAACCCCAGTAATGTTGATCACTATTCCAAACTACTGTTTCCTTTGATTTTTAT
GCTAGCCAATGTATTTTACTGGGCATACTACATGTATTTTACAGCTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTA
ACCCTCTCCTCGGTCTCGATTCTACGTAG

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CACNB4-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

 

Single Cell Clones: E3

Sequence

ORF Sequence:

ATGTCCTCCTCCTCCTACGCCAAGAACGGGACCGCGGACGGGCCGCACTCCCCCACCTCGCAGGTGGCCCGAGGCACCAC AACCCGGAGGAGCAGGTTGAAAAGATCCGATGGCAGCACCACTTCGACCAGCTTCATCCTCAGACAGGGTTCAGCGGATT CCTACACAAGCAGGCCGTCTGACTCCGATGTCTCTTTGGAAGAGGACCGGGAAGCAATTCGACAGGAGAGAGAACAGCAA GCAGCTATCCAGCTTGAGAGAGCAAAGTCCAAACCTGTAGCATTTGCCGTGAAGACAAATGTGAGCTACTGCGGCGCCCT GGACGAGGATGTGCCTGTTCCAAGCACAGCTATCTCCTTTGATGCTAAAGACTTTCTACATATTAAAGAGAAATATAACA ATGATTGGTGGATAGGAAGGCTGGTGAAAGAGGGCTGTGAAATTGGCTTCATTCCAAGTCCACTCAGATTGGAGAACATA CGGATCCAGCAAGAACAAAAAAGAGGACGTTTTCACGGAGGGAAATCAAGTGGAAATTCTTCTTCAAGTCTTGGAGAAAT GGTATCTGGGACATTCCGAGCAACTCCCACATCAACAGCAAAACAGAAGCAAAAAGTGACGGAGCACATTCCTCCTTACG ATGTTGTACCGTCAATGCGTCCGGTGGTGTTAGTGGGGCCGTCACTGAAAGGTTACGAGGTAACAGACATGATGCAGAAA GCCCTCTTTGATTTCCTGAAGCACAGGTTTGATGGGAGGATTTCAATAACGAGAGTGACAGCTGACATTTCTCTTGCTAA GAGGTCTGTCCTAAATAATCCCAGCAAGAGAGCAATAATTGAACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTACAAA GTGAAATTGAAAGAATCTTTGAGTTGGCAAGATCTTTGCAACTGGTTGTTCTTGATGCAGACACCATCAATCACCCAGCA CAACTTATAAAGACTTCCTTAGCACCAATTATTGTTCATGTAAAAGTCTCATCTCCAAAGGTTTTACAGCGGTTGATTAA ATCTAGAGGAAAGTCACAAAGTAAACACTTGAATGTTCAACTGGTGGCAGCTGATAAACTTGCACAATGCCCCCCAGAAA TGTTTGATGTTATATTGGATGAAAATCAGCTTGAGGATGCATGTGAACATCTAGGGGAGTACCTGGAGGCGTACTGGCGT GCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGGAAGGAATTTGGGCTCCACGGCACTCTCACCATATCC CACAGCAATTTCTGGGTTACAGAGTCAGCGAATGAGGCACAGCAACCACTCCACAGAGAACTCTCCAATTGAAAGACGAA GTCTAATGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGCAT AGCCGAGATCATTACCCTCTTGTGGAAGAAGATTACCCTGACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGG ATCACCTGGGGGATATAGCCATGACTCCCGACATAGGCTTTTGCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCC CTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CLIC5-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGACAGACTCGGCGACAGCTAACGGGGACGACAGGGACCCCGAGATCGAGCTCTTTGTGAAGGCTGGAATCGATGGAGA
AAGCATCGGCAACTGTCCTTTCTCTCAGCGCCTCTTCATGATCCTCTGGCTGAAAGGAGTCGTGTTCAATGTCACCACTG
TGGATCTGAAAAGAAAGCCAGCTGACCTGCACAACCTAGCCCCCGGCACGCACCCGCCCTTCCTGACCTTCAACGGGGAC
GTGAAGACAGACGTCAATAAGATCGAGGAGTTCCTGGAGGAGACCTTGACCCCTGAAAAGTACCCCAAACTGGCTGCAAA
ACACCGGGAATCCAACACAGCGGGCATCGACATCTTTTCCAAGTTTTCTGCCTACATCAAAAATACCAAGCAGCAGAACA
ATGCTGCTCTTGAAAGAGGCCTAACCAAGGCTCTAAAGAAATTGGATGACTACCTGAACACCCCTCTACCAGAGGAGATT
GACGCCAACACTTGTGGGGAAGACAAGGGGTCCCGGCGCAAGTTCCTGGATGGGGATGAGCTGACCCTGGCTGACTGCAA
TCTGTTGCCCAAGCTCCATGTGGTCAAGATTGTGGCCAAGAAATACCGCAACTATGATATCCCGGCTGAGATGACAGGCC
TGTGGCGGTACCTCAAGAACGCCTATGCCCGTGATGAGTTCACCAACACCTGTGCAGCTGACAGTGAGATCGAGTTGGCC
TACGCTGATGTCGCCAAACGCCTCAGCCGATCCTGCCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCC
TCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CHRND-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

 

Single Cell Clones:

 

Intracellular V5 expression is heterogenous.

Sequence

ORF Sequence:

ATGGAGGGGCCAGTGCTGACACTGGGGCTGCTGGCTGCCCTGGCGGTGTGTGGCAGCTGGGGGCTGAACGAGGAGGAGCG GCTGATCCGGCACCTGTTTCAAGAGAAGGGCTACAACAAGGAGCTCCGGCCCGTGGCACACAAAGAGGAGAGTGTGGACG TTGCCCTGGCCCTCACACTCTCCAACCTCATCTCCCTGAAAGAAGTTGAGGAGACCCTCACTACCAATGTGTGGATAGAG CACGGCTGGACAGACAACCGGCTGAAGTGGAATGCTGAAGAATTTGGAAACATCAGTGTCCTGCGCCTCCCCCCGGACAT GGTGTGGCTCCCAGAGATTGTGCTGGAGAACAACAATGACGGCTCCTTCCAGATCTCCTACTCCTGCAACGTGCTTGTCT ACCACTACGGCTTCGTGTACTGGCTGCCACCTGCCATCTTCCGCTCCTCCTGCCCCATCTCTGTCACCTATTTCCCCTTC GACTGGCAGAACTGCTCCCTCAAGTTCAGTTCCCTCAAGTATACGGCCAAAGAGATCACCCTGAGCCTGAAACAGGATGC CAAGGAGAACCGCACCTACCCCGTGGAGTGGATCATCATTGATCCTGAAGGCTTCACAGAGAACGGGGAGTGGGAGATAG TCCACCGGCCGGCCAGGGTCAACGTGGACCCCAGAGCCCCTCTGGACAGCCCCAGCCGCCAGGACATCACCTTCTACCTC ATCATCCGCCGCAAGCCCCTCTTCTACATCATCAACATCCTGGTGCCCTGCGTGCTCATCTCCTTCATGGTCAACCTGGT CTTCTACCTACCGGCTGACAGTGGTGAGAAGACATCAGTGGCCATCTCGGTGCTCCTGGCTCAGTCTGTCTTCCTGCTGC TCATCTCCAAGCGTCTGCCTGCCACATCCATGGCCATCCCCCTTATCGGCAAGTTCCTGCTCTTCGGCATGGTGCTGGTC ACCATGGTTGTGGTGATCTGTGTCATCGTGCTCAACATCCACTTCCGAACACCCAGCACCCATGTGCTGTCTGAGGGGGT CAAGAAGCTCTTCCTGGAGACCCTGCCGGAGCTCCTGCACATGTCCCGCCCAGCAGAGGATGGACCCAGCCCTGGGGCCC TGGTGCGGAGGAGCAGCTCCCTGGGATACATCTCCAAGGCCGAGGAGTACTTCCTGCTCAAGTCCCGCAGTGACCTCATG TTCGAGAAGCAGTCAGAGCGGCATGGGCTGGCCAGGCGCCTCACCACTGCACGCCGGCCCCCAGCAAGCTCTGAGCAGGC CCAGCAGGAACTCTTCAATGAGCTGAAGCCAGCTGTGGATGGGGCAAACTTCATTGTTAACCACATGAGGGACCAGAACA ATTACAATGAGGAGAAAGACAGCTGGAACCGAGTGGCCCGCACAGTGGACCGCCTCTGCCTGTTTGTGGTGACGCCTGTC ATGGTGGTGGGCACAGCCTGGATCTTCCTGCAGGGCGTTTACAACCAGCCACCACCCCAGCCTTTTCCTGGGGACCCCTA CTCCTACAACGTGCAGGACAAGCGCTTCATCTTGCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTC TCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CALHM4-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGTTTGATAATGTCAGTGCCAGCAAACGAGAAGAGATCCTAGCTGGGTTTCCATGTTGCAGATCAGCTCCTTCTGACGT
GATCCTAGTAAGAGATGAAATAGCTCTTCTGCACAGATACCAGTCACAGATGCTGGGTTGGATTTTGATCACCTTGGCAA
CCATTGCTGCCTTAGTCTCCTGCTGTGTGGCAAAGTGCTGCTCTCCCCTCACCTCTCTGCAACATTGCTACTGGACCAGC
CACCTCCAGAATGAGAGAGAACTCTTTGAACAAGCAGCAGAGCAGCACTCTCGGCTCCTCATGATGCATCGCATAAAGAA
GCTATTTGGCTTCATTCCCGGGAGTGAAGACGTCAAACACATCCGCATTCCTTCTTGTCAGGACTGGAAAGATATTTCAG
TACCCACTCTTTTATGCATGGGTGATGACTTGCAAGGTCACTATAGCTTCCTTGGAAATAGGGTGGATGAGGATAATGAG
GAAGACAGATCAAGAGGTATTGAATTAAAACCTACAGCTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCT
CCTCGGTCTCGATTCTACGTAG

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CACNG1-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

 

Single-Cell Clones:

A4 A6 A11 

A7 Possibly clonal

V5 Expression is membranous. Expression between clones looks homogenous. Cells appear to be performing exocytosis (see punta).

Sequence

ORF Sequence:

ATGTCCCAGACCAAAATGCTGAAGGTCCGCGTGACCCTCTTCTGCATCCTGGCAGGCATCGTGCTGGCCATGACAGCCGT GGTAACCGACCACTGGGCTGTGCTGAGCCCCCACATGGAGCACCACAACACTACCTGCGAGGCGGCCCACTTCGGCCTCT GGCGGATTTGTACCAAGCGCATCCCCATGGACGACAGCAAGACCTGCGGGCCCATCACCCTGCCCGGGGAGAAGAACTGT TCCTACTTCAGGCATTTTAACCCCGGCGAGAGCTCGGAGATCTTCGAATTCACCACTCAGAAGGAGTACAGCATCTCGGC AGCCGCCATCGCCATCTTCAGCCTTGGCTTCATCATCCTGGGCAGCCTCTGTGTCCTCCTGTCCCTCGGGAAGAAGAGGG ACTATCTGCTGCGACCCGCGTCCATGTTCTATGCCTTTGCAGGTCTCTGCATCCTCGTCTCGGTGGAGGTCATGCGGCAG TCGGTGAAGCGCATGATTGACAGTGAGGACACCGTCTGGATCGAGTACTATTACTCCTGGTCCTTTGCCTGCGCCTGTGC CGCCTTCATCCTCCTCTTTCTCGGCGGTCTCGCCCTCCTGCTGTTCTCCCTGCCTCGAATGCCCCGGAACCCATGGGAGT CCTGCATGGATGCTGAGCCCGAGCACTTGCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTC GGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CNGA4-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGAGCCAGGACACCAAAGTGAAGACAACAGAGTCCAGTCCCCCAGCCCCATCCAAGGCCAGGAAGTTGCTGCCTGTCCT
GGACCCATCTGGGGATTACTACTACTGGTGGCTGAACACAATGGTCTTCCCAGTCATGTATAACCTCATCATCCTCGTGT
GCAGAGCCTGCTTCCCCGACTTGCAGCACGGTTATCTGGTGGCCTGGTTGGTGCTGGACTACACGAGTGACCTGCTATAC
CTACTAGACATGGTGGTGCGCTTCCACACAGGATTCTTGGAACAGGGCATCCTGGTGGTGGACAAGGGTAGGATCTCGAG
TCGCTACGTTCGCACCTGGAGTTTCTTCTTGGACCTGGCTTCCCTGATGCCCACAGATGTGGTCTACGTGCGGCTGGGCC
CGCACACACCCACCCTGAGGCTGAACCGCTTTCTCCGCGCGCCCCGCCTCTTCGAGGCCTTCGACCGCACAGAGACCCGC
ACAGCTTACCCAAATGCCTTTCGCATTGCCAAGCTGATGCTTTACATTTTTGTCGTCATCCATTGGAACAGCTGCCTATA
CTTTGCCCTATCCCGGTACCTGGGCTTCGGGCGTGACGCATGGGTGTACCCGGACCCCGCGCAGCCTGGCTTTGAGCGCC
TGCGGCGCCAGTACCTCTATAGCTTTTACTTCTCCACGCTGATACTGACTACAGTGGGCGATACACCGCCGCCAGCCAGG
GAAGAAGAGTACCTCTTCATGGTGGGCGACTTCCTGCTGGCCGTCATGGGTTTCGCCACCATCATGGGTAGCATGAGCTC
TGTCATCTACAACATGAACACTGCAGATGCGGCTTTCTACCCAGATCATGCACTGGTGAAGAAGTACATGAAGCTGCAGC
ACGTCAACCGCAAGCTGGAGCGGCGAGTTATTGACTGGTATCAGCACCTGCAGATCAACAAGAAGATGACCAACGAGGTA
GCCATCTTACAGCACTTGCCTGAGCGGCTGCGGGCAGAAGTGGCTGTGTCTGTGCACCTGTCCACTCTGAGCCGGGTGCA
GATCTTTCAGAACTGTGAGGCCAGCCTGCTGGAGGAGCTGGTGCTGAAGCTGCAGCCCCAGACCTACTCACCAGGTGAAT
ATGTATGCCGCAAAGGAGACATTGGCCAAGAGATGTACATCATCCGAGAGGGTCAACTGGCCGTGGTGGCAGATGATGGT
ATCACACAGTATGCTGTGCTCGGTGCAGGGCTCTACTTTGGGGAGATCAGCATCATCAACATCAAAGGGAACATGTCTGG
GAACCGCCGCACAGCCAACATCAAGAGCCTAGGTTATTCAGACCTATTCTGCCTGAGCAAGGAGGACCTGCGGGAGGTGC
TGAGCGAGTATCCACAAGCACAGACCATCATGGAGGAGAAAGGACGTGAGATCCTGCTGAAAATGAACAAGTTGGACGTG
AATGCTGAGGCAGCTGAGATCGCCCTGCAGGAGGCCACAGAGTCCCGGCTACGAGGCCTAGACCAGCAGCTGGATGATCT
ACAGACCAAGTTTGCTCGCCTCCTGGCTGAGCTGGAGTCCAGCGCACTTAAGATTGCTTACCGCATTGAACGGCTGGAGT
GGCAGACTCGAGAGTGGCCAATGCCCGAGGACCTGGCTGAGGCTGATGACGAGGGTGAGCCTGAGGAGGGAACTTCCAAA
GATGAAGAGGGCAGGGCCAGCCAGGAGGGACCCCCAGGTCCAGAGTTGCCAACTTTCTTGTACAAAGTGGTTGGTAAGCC
TATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTAG

Media and Files

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CLCA4-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

Sequence

ORF Sequence:

ATGGGGTTATTCAGAGGTTTTGTTTTCCTCTTAGTTCTGTGCCTGCTGCACCAGTCAAATACTTCCTTCATTAAGCTGAA
TAATAATGGCTTTGAAGATATTGTCATTGTTATAGATCCTAGTGTGCCAGAAGATGAAAAAATAATTGAACAAATAGAGG
ATATGGTGACTACAGCTTCTACGTACCTGTTTGAAGCCACAGAAAAAAGATTTTTTTTCAAAAATGTATCTATATTAATT
CCTGAGAATTGGAAGGAAAATCCTCAGTACAAAAGGCCAAAACATGAAAACCATAAACATGCTGATGTTATAGTTGCACC
ACCTACACTCCCAGGTAGAGATGAACCATACACCAAGCAGTTCACAGAATGTGGAGAGAAAGGCGAATACATTCACTTCA
CCCCTGACCTTCTACTTGGAAAAAAACAAAATGAATATGGACCACCAGGCAAACTGTTTGTCCATGAGTGGGCTCACCTC
CGGTGGGGAGTGTTTGATGAGTACAATGAAGATCAGCCTTTCTACCGTGCTAAGTCAAAAAAAATCGAAGCAACAAGGTG
TTCCGCAGGTATCTCTGGTAGAAATAGAGTTTATAAGTGTCAAGGAGGCAGCTGTCTTAGTAGAGCATGCAGAATTGATT
CTACAACAAAACTGTATGGAAAAGATTGTCAATTCTTTCCTGATAAAGTACAAACAGAAAAAGCATCCATAATGTTTATG
CAAAGTATTGATTCTGTTGTTGAATTTTGTAACGAAAAAACCCATAATCAAGAAGCTCCAAGCCTACAAAACATAAAGTG
CAATTTTAGAAGTACATGGGAGGTGATTAGCAATTCTGAGGATTTTAAAAACACCATACCCATGGTGACACCACCTCCTC
CACCTGTCTTCTCATTGCTGAAGATCAGTCAAAGAATTGTGTGCTTAGTTCTTGATAAGTCTGGAAGCATGGGGGGTAAG
GACCGCCTAAATCGAATGAATCAAGCAGCAAAACATTTCCTGCTGCAGACTGTTGAAAATGGATCCTGGGTGGGGATGGT
TCACTTTGATAGTACTGCCACTATTGTAAATAAGCTAATCCAAATAAAAAGCAGTGATGAAAGAAACACACTCATGGCAG
GATTACCTACATATCCTCTGGGAGGAACTTCCATCTGCTCTGGAATTAAATATGCATTTCAGGTGATTGGAGAGCTACAT
TCCCAACTCGATGGATCCGAAGTACTGCTGCTGACTGATGGGGAGGATAACACTGCAAGTTCTTGTATTGATGAAGTGAA
ACAAAGTGGGGCCATTGTTCATTTTATTGCTTTGGGAAGAGCTGCTGATGAAGCAGTAATAGAGATGAGCAAGATAACAG
GAGGAAGTCATTTTTATGTTTCAGATGAAGCTCAGAACAATGGCCTCATTGATGCTTTTGGGGCTCTTACATCAGGAAAT
ACTGATCTCTCCCAGAAGTCCCTTCAGCTCGAAAGTAAGGGATTAACACTGAATAGTAATGCCTGGATGAACGACACTGT
CATAATTGATAGTACAGTGGGAAAGGACACGTTCTTTCTCATCACATGGAACAGTCTGCCTCCCAGTATTTCTCTCTGGG
ATCCCAGTGGAACAATAATGGAAAATTTCACAGTGGATGCAACTTCCAAAATGGCCTATCTCAGTATTCCAGGAACTGCA
AAGGTGGGCACTTGGGCATACAATCTTCAAGCCAAAGCGAACCCAGAAACATTAACTATTACAGTAACTTCTCGAGCAGC
AAATTCTTCTGTGCCTCCAATCACAGTGAATGCTAAAATGAATAAGGACGTAAACAGTTTCCCCAGCCCAATGATTGTTT
ACGCAGAAATTCTACAAGGATATGTACCTGTTCTTGGAGCCAATGTGACTGCTTTCATTGAATCACAGAATGGACATACA
GAAGTTTTGGAACTTTTGGATAATGGTGCAGGCGCTGATTCTTTCAAGAATGATGGAGTCTACTCCAGGTATTTTACAGC
ATATACAGAAAATGGCAGATATAGCTTAAAAGTTCGGGCTCATGGAGGAGCAAACACTGCCAGGCTAAAATTACGGCCTC
CACTGAATAGAGCCGCGTATATACCAGGCTGGGTAGTGAACGGGGAAATTGAAGCAAACCCGCCAAGACCTGAAATTGAT
GAGGATACTCAGACCACCTTGGAGGATTTCAGCCGAACAGCATCCGGAGGTGCATTTGTGGTATCACAAGTCCCAAGCCT
TCCCTTGCCTGACCAATACCCACCAAGTCAAATCACAGACCTTGATGCCACAGTTCATGAGGATAAGATTATTCTTACAT
GGACAGCACCAGGAGATAATTTTGATGTTGGAAAAGTTCAACGTTATATCATAAGAATAAGTGCAAGTATTCTTGATCTA
AGAGACAGTTTTGATGATGCTCTTCAACTAAATACTACTGATCTGTCACCAAAGGAGGCCAACTCCAAGGAAAGCTTTGC
ATTTAAACCAGAAAATATCTCAGAAGAAAATGCAACCCACATATTTATTGCCATTAAAAGTATAGATAAAAGCAATTTGA
CATCAAAAGTATCCAACATTGCACAAGTAACTTTGTTTATCCCTCAAGCAAATCCTGATGACATTGATCCTACACCTACT
CCTACTCCTACTCCTGATAAAAGTCATAATTCTGGAGTTAATATTTCTACGCTGGTATTGTCTGTGATTGGGTCTGTTGT
AATTGTTAACTTTATTTTAAGTACCACCATTTTGCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTC
TCCTCGGTCTCGATTCTACGTAG

Media and Files