Skip to main content
Loading...

Basic Information

Parent Cell Line:
HEK293
Gene Taxonomy:
Cell Line Taxonomy:
Cell Type:
Stable overexpression cell line
Cell ID:
IDG-HEK293T-CACNG1-V5-OE
Selection:
Blasticidin to a final concentration of 10μg/m
Organism:
Homo sapiens, human
Description:

This cell line stably expresses dark ion channel in frame with V5 tag on the C-terminus. The ion channel construct is randomly integrated in the genome using lentiviral transduction. This cell line also expresses gene conferring Blasticidin resistance. These cells lines can be used for various molecular and biochemical characterizations of dark ion channels in vitro.

 

Single-Cell Clones:

A4 A6 A11 

A7 Possibly clonal

V5 Expression is membranous. Expression between clones looks homogenous. Cells appear to be performing exocytosis (see punta).

Sequence

ORF Sequence:

ATGTCCCAGACCAAAATGCTGAAGGTCCGCGTGACCCTCTTCTGCATCCTGGCAGGCATCGTGCTGGCCATGACAGCCGT GGTAACCGACCACTGGGCTGTGCTGAGCCCCCACATGGAGCACCACAACACTACCTGCGAGGCGGCCCACTTCGGCCTCT GGCGGATTTGTACCAAGCGCATCCCCATGGACGACAGCAAGACCTGCGGGCCCATCACCCTGCCCGGGGAGAAGAACTGT TCCTACTTCAGGCATTTTAACCCCGGCGAGAGCTCGGAGATCTTCGAATTCACCACTCAGAAGGAGTACAGCATCTCGGC AGCCGCCATCGCCATCTTCAGCCTTGGCTTCATCATCCTGGGCAGCCTCTGTGTCCTCCTGTCCCTCGGGAAGAAGAGGG ACTATCTGCTGCGACCCGCGTCCATGTTCTATGCCTTTGCAGGTCTCTGCATCCTCGTCTCGGTGGAGGTCATGCGGCAG TCGGTGAAGCGCATGATTGACAGTGAGGACACCGTCTGGATCGAGTACTATTACTCCTGGTCCTTTGCCTGCGCCTGTGC CGCCTTCATCCTCCTCTTTCTCGGCGGTCTCGCCCTCCTGCTGTTCTCCCTGCCTCGAATGCCCCGGAACCCATGGGAGT CCTGCATGGATGCTGAGCCCGAGCACTTGCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTC GGTCTCGATTCTACGTAG

Media and Files

Basic Information

Gene Taxonomy:
Virus Type:
Vector Type:
Construct ID:
IDG_CACNG1_OE_1

Selection:
Amp, Blasticidin

Vector:
lPX304

Construct Type:
Expression

Tag:
C terminal V5

Passed QC:
Yes

Sequence

Inserted_sequence:
ATGTCCCAGACCAAAATGCTGAAGGTCCGCGTGACCCTCTTCTGCATCCTGGCAGGCATCGTGCTGGCCATGACAGCCGT
GGTAACCGACCACTGGGCTGTGCTGAGCCCCCACATGGAGCACCACAACACTACCTGCGAGGCGGCCCACTTCGGCCTCT
GGCGGATTTGTACCAAGCGCATCCCCATGGACGACAGCAAGACCTGCGGGCCCATCACCCTGCCCGGGGAGAAGAACTGT
TCCTACTTCAGGCATTTTAACCCCGGCGAGAGCTCGGAGATCTTCGAATTCACCACTCAGAAGGAGTACAGCATCTCGGC
AGCCGCCATCGCCATCTTCAGCCTTGGCTTCATCATCCTGGGCAGCCTCTGTGTCCTCCTGTCCCTCGGGAAGAAGAGGG
ACTATCTGCTGCGACCCGCGTCCATGTTCTATGCCTTTGCAGGTCTCTGCATCCTCGTCTCGGTGGAGGTCATGCGGCAG
TCGGTGAAGCGCATGATTGACAGTGAGGACACCGTCTGGATCGAGTACTATTACTCCTGGTCCTTTGCCTGCGCCTGTGC
CGCCTTCATCCTCCTCTTTCTCGGCGGTCTCGCCCTCCTGCTGTTCTCCCTGCCTCGAATGCCCCGGAACCCATGGGAGT
CCTGCATGGATGCTGAGCCCGAGCACTTGCCAACTTTCTTGTACAAAGTGGTTGGTAAGCCTATCCCTAACCCTCTCCTC
GGTCTCGATTCTACGTAG

Media and Files